Annals of Clinical & Laboratory Science 40:149-155 (2010)
© 2010 Association of Clinical Scientists
Association of Interleukin-10 Gene Polymorphism with Cachexia in Chinese Patients with Gastric Cancer
Fengbo Sun1,
Yunbo Sun2,
Dianliang Zhang1,
Jian Zhang1,
Bo Song3 and
Hongmei Zheng1
1 General Surgery and 2 Intensive Care Departments, Qingdao University Medical College and Hospital; 3 Yantai Yantaishan Hospital; Shandong Province, China
Address correspondence to Dr. Dianliang Zhang, Department of General Surgery, Affiliated Hospital of Qingdao University Medical College, 16 Jiangsu Road, Qingdao 266003, Shandong Province, P. R. China; tel 86 532 8291 1324; fax 86 532 8279 0962; e-mail: phdzdl{at}yahoo.com.
 |
Abstract
|
|---|
This study investigated whether the single nucleotide polymorphisms (SNPs) and haplotypes of interleukin-10 (IL-10) were associated with cachexia in 223 Chinese patients with gastric cancer diagnosed by histopathological examination. Genomic DNA was extracted from peripheral blood leukocytes. The SNPs at positions –1082A/G, –819T/C, and –592A/C in the IL-10 gene promoter were analyzed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). No significant differences were found in the allele and genotype frequencies of –592A/C in patients with or without cachexia. Increased frequency of the –1082G allele was found in patients with cachexia (OR = 1.83, 95% CI, 1.00–3.33, p = 0.049). In a logistic regression analysis adjusted for body weight, carcinoma location, and stage, the –1082AG genotype was associated with an odds ratio of 1.989 (95% CI, 1.041–3.802, p = 0.037) for cachexia. The –819CC genotype was associated with an odds ratio of 3.393 (95% CI, 1.298–8.871, p = 0.013) for cachexia. Furthermore, haplotype analysis revealed that the G1082C819C592 haplotype was associated with increased risk of cachexia as compared to the A1082T819A592 haplotype (OR = 2.21; 95% CI, 1.14 – 4.30; p = 0.02). Our results suggest that genetic polymorphisms of IL-10 contribute to the susceptibility to cachexia in patients with gastric cancer in the Chinese population.
Keywords: interleukin-10, single nucleotide polymorphisms, haplotype analysis, gastric cancer, cachexia
 |
Introduction
|
|---|
Cancer cachexia is a complex syndrome characterized by progressive weight loss, anorexia, early satiety, weakness, anemia, and asthenia [1,2]. It is most commonly seen in patients with gastrointestinal, lung, and prostate cancers. At the time of diagnosis, up to 80% of patients with cancers of the upper digestive tract and 60% of patients with lung cancer suffer from cachexia [3]. Cachexia causes reduced quality of life and shortened life expectancy. Patients with cachexia have a lower chance of responding to chemotherapy and are more prone to toxic side-effects [4]. At least 20% of cancer patients die from effects of cachexia [5,6].
Although the mechanism of cancer cachexia is not well known, several key mediators have been identified. Inflammatory cytokines such as TNF-
, IFN-
, IL-1, IL-6, and IL-10 evidently play an important role in the pathogenesis of cancer cachexia [7–12]. There is evidence that the cytokine response is genetically determined in humans [13]. Polymorphic gene sequences of certain cytokines can influence the susceptibility to and clinical outcome of various diseases by changing cytokine production. Several studies have explored the likehood of a genetic predisposition to cancer cachexia [13–15].
Interleukin-10 (IL-10) is a pleiotrophic cytokine that can both stimulate and suppress the immune response [16]. Previous studies have suggested that IL-10 plays an important role in cachexia from pancreatic cancer and colorectal cancer [17,18]. The human IL-10 gene is located on chromosome 1q31–32 and is composed of five exons and four introns. Three SNPs at positions –1082A/G, –819T/C, and –592A/C influence the transcription of IL-10 messenger RNA and the expression of IL-10. In addition, the GCC haplotype (defined by three SNPs at positions of –1082, –819 and –592) is associated with high IL-10 production, while the ATA haplotype appears to be a low IL-10 responder [19,20]. A recent study showed that the IL-10 genotype can influence the development of cachexia in patients with gastro-esophageal malignancy [21]. However, that study was focused only on the IL-10-1082 locus.
In the present study, we genotyped the IL-10 gene in 223 Chinese patients with gastric cancer to evaluate the effect of the common –1082A/G, –819T/C, and –592A/C polymorphisms on the susceptibility to cancer cachexia.
 |
Materials and Methods
|
|---|
Study population.
From 1 October 2008 through 1 May 2009, all patients with gastric cancer admitted to the hospital for surgical treatment were prospectively considered. The exclusion criteria were: (a) age >75 yr; (b) anorexia nervosa; (c) surgery, radiotherapy, or chemotherapy during the previous 4 wk; and (d) other active medical conditions (major gastrointestinal disease, chronic heart failure, hepatic failure, renal failure, uncontrolled diabetes, infections, and HIV).
All of the cases were from the Chinese Han population. The diagnosis of gastric cancer was established by histopathological examination. Each case was evaluated for the presence of anorexia, serum C-reactive protein (CRP) level, and weight loss. The patients were divided into two groups: cachectic patients and non-cachectic patients, based on the severity of weight loss during the preceding 6 mo and the serum CRP level at admission. Patients were considered cachectic if their weight loss was >10% of their pre-illness stable weight within 6 mo and if their serum CRP level was >10 mg/L [22].
Cancers were staged according to the International Union Against Cancer (UICC) TNM system [23]. The characteristics of the study patients are shown in Table 1
. Informed consent was obtained using a questionnaire completed by each participating subject or a close relative. The study protocol was approved by the Ethics Committee of Qingdao University.
IL-10 measurement.
At 6 a.m. on the first day after admission, peripheral venous blood was collected from each subject before any therapy was given. All subjects were fasting. Serum IL-10 levels were measured with an interleukin radio-immunoassay kit (Beijing Sino-UK Institute of Biological Technology, Beijing, China) according to the manufacturers instructions.
Genotyping.
Genomic DNA was extracted from EDTA-anticoagulanted peripheral blood leukocytes using a Wizard genomic DNA purification kit (Promega) according to the manufacturers instructions. The IL-10 –1082A/G, –819T/C and –592A/C genotypes were determined by a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique using primers from Shanghai Sangon Biological Engineeering Technology and Services Co.
IL-10-1082A/G.
The primers were as follows: forward: 5'CCAAGACAACACTACTAAGGCTCCTTT3'; reverse: 5'GCTTCTTATATGCTAGTCAGGTA3' [24]. PCR conditions: 94°C 5 min; 35 cycles of 30 sec at 94°C, 45 sec at 56°C, 1 min at 72°C; 72°C 10 min. PCR products were 377bp and digested with 5 units of restriction enzyme EcoNI (New England Biolabs) at 37°C overnight. Digestion products of 280bp + 97bp and 253bp + 97bp + 27bp were obtained for A and G alleles, respectively, visualized by electrophoresis on a 3% agarose gel stained with 0.1% ethidium bromide (Fig.1
).

View larger version (87K):
[in this window]
[in a new window]
|
Fig. 1. PCR-RFLP assay of –1082A/G IL-10 polymorphism. Lanes 1, 3, 5, 6, and 7 = homozygous AA genotype, A allele cut with EcoNI generating 280- and 97-bp fragments. Lanes 2 and 4 = heterozygous AG genotype, A allele cut with EcoNI generating 280- and 97-bp fragments. Not shown: G allele cut with EcoNI generating 253-,97- and 27-bp fragments. Lane M = bp marker.
|
|
IL-10-819T/C.
The primers were as follows: forward: 5'TCATTCTATGTGCTGGAGATGG3'; reverse: 5'TGGGGGAAGTGGGTAAGAGT-3' [25]. PCR conditions: 94°C 5 min; 35 cycles of 30 sec at 94°C, 45 sec at 56°C, 1 min at 72°C; 72°C 10 min. PCR products were 209bp and digested with 5 units of restriction enzyme MaeIII (Roche) at 55°C for 1 hr. Digestion products of 125bp + 84bp and 209bp were obtained for C and T alleles, respectively, visualized by electrophoresis on a 3% agarose gel stained with 0.1% ethidium bromide (Fig. 2
).

View larger version (75K):
[in this window]
[in a new window]
|
Fig. 2. PCR-RFLP assay of -819T/C IL-10 polymorphism. Lane 4 = homozygous CC genotype, C allele cut with MaeIII generating 125- and 84-bp fragments. Lanes 1 and 6 = heterozygous CT genotype, C allele cut with MaeIII generating 125- and 84-bp fragments, while T allele does not cut. Lanes 2, 3, 5, and 7 = homozygous TT genotype, T allele does not cut, only 209-bp fragment. Lane M = bp marker.
|
|
IL-10-592A/C.
The primers were as follows: forward: 5'GGTGAGCACTACCTGACTAGC3'; reverse: 5'CCTAGGTCACAGTGACGTGG3' [25]. PCR conditions: 94°C 5 min; 35 cycles of 30 sec at 94°C, 45 sec at 64°C, 1 min at 72°C; 72°C 10 min. PCR products were 412bp and digested with 5 units of restriction enzyme RsaI (MBI Fermentas) at 37°C for 4 hr. Digestion products of 176 bp + 236bp and 412bp were obtained for A and C alleles, respectively, visualized by electrophoresis on a 3% agarose gel stained with 0.1% ethidium bromide (Fig. 3
).

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 3. PCR-RFLP assay of -592A/C IL-10 polymorphism. Lanes 2, 4, 5, and 6 = homozygous AA genotype, A allele cut with RsaI generating 176- and 236-bp fragments. Lanes 3 and 7 = heterozygous AC genotype, A allele cut with RsaI generating 176- and 236-bp fragments, while C allele does not cut. Lane 1 = homozygous CC genotype, C allele does not cut, only 412-bp fragment. Lane M = bp marker.
|
|
Statistics.
Serum IL-10 levels were expressed as mean ± SD and compared by the Mann-Whitney U test. The Chi-square test and 2-sample t test were used to compare the demographic and clinical data between groups. The Chi-square test was used to test the distributions of genotype at each SNP locus with Hardy-Weinberg equilibrium. Genotype and allele frequencies among groups were compared using the Chi-square test and Fishers exact test as appropriate. Odds ratios (OR) with 95% confidence intervals (CIs) were estimated for the relative risk conferred by a particular allele and genotype. To provide separate odds ratios (ORs) for each genotype, the most common genotype was considered as the reference group. Haplotypes and linkage disequilibrium (LD) were determined based on an expectation-maximization algorithm by the SNPStats program (http://bioinfo.iconcologia.net/ SNPstats; Biostatistics and Bioinformatics Unit, Catalan Institute of Oncology, Barcelona, Spain). Logistic regression was applied to identify independent predictors of the cachexia. Statistical analyses were performed using the SPSS statistical software package (version 12.0). The p values were two-sided and p <0.05 was deemed significant.
 |
Results
|
|---|
Characteristics of the study population.
Based on the selection criteria, 223 patients with gastric cancer were studied. Of these, 107 patients had >10% weight loss within a 6-mo period and serum CRP level >10 mg/L (ie, cachectic patients). The characteristics of the study groups are shown in Table 1
. The carcinoma stages were significantly different in the 2 groups (p <0.001). No significant differences were noted in sex, age, or tumor site in the patients with cachexia vs those without. The serum levels of IL-10 in the cachectic patients were significantly higher than those in the non-cachectic patients (p <0.001) (Fig. 4
).
Genotype and allele frequencies of IL-10.
The genotype and allele frequencies of the IL-10 gene –1082A/G, –819T/C, and –592A/C polymorphisms for all the studied variations are summarized in Table 2
. Within each study group, the genotype distributions were consistent with those predicted by the Hardy-Weinberg equilibrium.
There were significant differences in the genotype frequencies of the IL-10 gene –1082A/G and –819T/C polymorphisms in patients with cachexia vs those without (Table 2
) (p = 0.036 and 0.024, respectively). In a logistic regression analysis adjusted for body weight, carcinoma location, and tumor stage, the –1082AG and –819CC genotypes were associated with an increased risk of cachexia (–1082AG: OR = 1.989, 95% CI, 1.041–3.802, p = 0.037; –819CC: OR = 3.393, 95% CI, 1.298–8.871, p = 0.013). In addition, the –1082G allele was associated with an increased risk of cachexia as compared to the –1082A allele (OR = 1.83, 95% CI,1.00–3.33, p = 0.049). No significant difference was found in the distribution of the IL-10 –592 A/C polymorphisms in cachectic patients vs non-cachectic patients.
Association between IL-10 gene polymorphism and serum levels of IL-10 in gastric cancer patients.
The IL-10-1082AG genotype was associated with higher IL-10 production as compared to the –1082AA genotype (p <0.001). Similarly, the –819CC genotype was associated with higher IL-10 production as compared to the –819TT genotype (p = 0.040) (Fig. 5
).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 5. The association between IL-10 gene polymorphism and the levels of IL-10 in serum of patients with gastric cancer.
|
|
Haplotype analysis of the IL-10 gene.
Haplotype analyses were performed and the 5 possible haplotype frequencies are shown in Table 3
. Linkage disequilibrium (LD) was observed between allele A at locus –1082 and allele T at locus –819 [D' = 0.9989]; betwen allele A at locus –1082 and allele A at locus-592 [D' = 0.9989]; and between allele T at locus –819 and allele A at locus –592 [D' = 0.9408]. Haplotype analysis revealed that the major A1082T819A592 haplotype accounted for 58.8% and 67.2% of these 5 haplotypes in the cachectic and non-cachectic patients, respectively. By haplotype analysis, we found that the G1082C819C592 haplotype was associated with a significantly increased risk of cachexia as compared to the A1082T819A592 haplotype (OR = 2.21; 95% CI, 1.14 – 4.30; p = 0.02).
 |
Discussion
|
|---|
In this study, we investigated the IL-10 gene polymorphisms –1082A, –819T, and –592A in Chinese patients with gastric cancer. There were no significant differences in the distribution of the IL-10 –592A/C polymorphisms in cachectic vs non-cachectic patients. However, the –1082AG and –819CC genotypes were associated with increased risk of cachexia and the frequency of the –1082G allele was increased in patients with cachexia. Since the primary tumor and distant metastasis may be associated with the levels of pro-cachectic cytokines in cancer patients [26,27], we performed logistic regression analysis adjusted for body weight, carcinoma location, and stage, and found that the differences were statistically significant. Haplotype analysis revealed that the G1082C819C592 haplotype was associated with significantly increased risk of cachexia. To the best of our knowledge, very few studies have evaluated the association between haplotypes of IL-10 and cachexia in patients with gastric cancer.
High levels of serum IL-10 in cachectic patients with cancer have been reported [17]. In agreement with this previous study, we found that the serum levels of IL-10 were significantly higher in the cachectic patients than in non-cachectic patients. Elevated circulating IL-10 concentrations may result in a systemic inflammatory response, which, in turn, causes the development of cachexia. It has been previously demonstrated that the –1082G allele and GCC haplotype were associated with increased IL-10 production [19,20]. Thus it is possible that genetic variations of IL-10 can influence the susceptibility to cachexia through changing the expression of IL-10. A recent study by Deans et al [21] showed that cancer cachexia is associated with the IL-10-1082 gene promoter polymorphism in patients with gastroesophageal malignancy, but this study did not report the IL-10 cytokine levels. In our study, we measured the IL-10 levels and found they were significantly elevated in cachectic patients. Moreover, the elevated cytokine levels were associated with their genotypes. In agreement with the findings of Deans et al [21], our study demonstrated that the –1082G allele influenced the occurrence of cachexia.
Noteworthy, in our study, no –1082GG genotype was found, but at least five haplotypes (ATA, ACC, GCC, ACA, and ATC) were found in the Chinese subjects. This is significantly different from those of Italian and UK populations, but is comparable to that found in a previous study of the Chinese population by Du et al [28]. The reason may be that the genotype/haplotype frequencies of IL-10 promoter SNPs in different populations have wide differences according to ethnicity [29,30].
In addition, we found the –819CC genotype to be associated with significantly increased risk of cachexia; the –819CC genotype correlated with higher IL-10 levels as compared to the –819TT genotype in the Chinese population. It is possible that –819CC influences the occurrence of cachexia by increasing IL-10 production in the Chinese population, which has not been reported previously. However, due to the relatively small sample size and a relatively high p value (p = 0.040) in our study, we cannot be certain that it is not a false-positive result. Thus, more studies are needed of the association between –819C/T polymorphisms and IL-10 production.
In conclusion, our results suggest that IL-10-1082G allele and –819C/C genotype and the G1082C819C592 haplotype are associated with susceptibility to cachexia in Chinese patients with gastric cancer. There are some limitations in our study. Since the numbers of cachectic and non-cachectic patients were relatively small, further studies with larger sample sizes are needed to document the genetic effects of IL-10 polymorphisms on cachexia from gastric cancer.
 |
Acknowledgements
|
|---|
This investigation was supported in part by grants from Shandong Natural Foundation (Y2006C20) and the Key Project of Shandong Scientific and Technology (2008GG30002034).
 |
References
|
|---|
- Tan BH, Deans DA, Skipworth RJ, Ross JA, Fearon KC. Biomarkers for cancer cachexia: is there also a genetic component to cachexia? Support Care Cancer 2008;16:229–234.[Medline]
- Dianliang Z. Probing cancer cachexia-anorexia: recent results with knockout, transgene and polymorphisms. Curr Opin Clin Nutr Metab Care 2009;12:227–231.[Medline]
- Inui A. Cancer cachexia–anorexia syndrome: current issues in research and management. CA Cancer J Clin 2002;52:72–91.[Medline]
- Slaviero KA, Read JA, Clarke SJ, Rivory LP. Baseline nutritional assessment in advanced cancer patients receiving palliative chemotherapy. Nutr Cancer 2003; 46:148–157.[Medline]
- Ryan JL, Carroll JK, Ryan EP, Mustian KM, Fiscella K, Morrow GR. Mechanisms of cancer-related fatigue. Oncologist 2007;12(Suppl 1):22–34.[Abstract/Free Full Text]
- Pirlich M, Norman K, Lochs H, Bauditz J. Role of intestinal function in cachexia. Curr Opin Clin Nutr Metab Care 2006; 9:603–606.[Medline]
- Argiles JM, Busquets S, Garcia-Martonez C, Lopez-Soriano F. Mediators involved in the cancer anorexia–cachexia syndrome: past, present, and future. Nutrition 2005;21:977–985.[Medline]
- McNamara MJ, Alexander HR, Norton JA. Cytokines and their role in the pathophysiology of cancer cachexia. J Parenter Enteral Nutr 1992;16:50S–55S.[Abstract/Free Full Text]
- Tisdale MJ. Isolation of a novel cancer cachectic factor. Proc Nutr Soc 1997;56:777–783.[Medline]
- Balkwill F, Mantovani A. Inflammation and cancer: back to Virchow? Lancet 2001;357:539–545.[Medline]
- Tisdale MJ. Biomedicine. Protein loss in cancer cachexia. Science 2000;289:2293–2294.[Free Full Text]
- Tisdale MJ. Metabolic abnormalities in cachexia and anorexia. Nutrition 2000;16:1013–1014.[Medline]
- Zhang D, Zheng H, Zhou Y, Tang X, Yu B, Li J. Association of IL-1-beta gene polymorphism with cachexia from locally advanced gastric cancer. BMC Cancer 2007;7:45.[Medline]
- Zhang D, Zhou Y, Wu L, Wang S, Zheng H, Yu B, Li J. Association of IL-6 gene polymorphisms with cachexia susceptibility and survival time of patients with pancreatic cancer. Ann Clin Lab Sci 2008;38:113–119.[Abstract/Free Full Text]
- Li FN, Zhang DL, Li YD, Jiang GM. Association of cytokine gene polymorphisms with cachexia related to sporadic female breast cancer. Zhonghua Yi Xue Za Zhi 2008;88:1402–1404.[Medline]
- Mocellin S, Marincola FM, Young HA. Interleukin-10 and the immune response against cancer: a counterpoint. J Leukoc Biol 2005;78:1043–1051.[Abstract/Free Full Text]
- Shibata M, Nezu T, Takekawa M, Takizawa H, Ando K, Miyake H, Amano S, Kurosu Y. Serum levels of interleukin-10 and interleukin-12 in patients with colorectal cancer. Ann N Y Acad Sci 1996;795:410–412.[Medline]
- Ebrahimi B, Tucker SL, Li D, Abbruzzese JL, Kurzrock R. Cytokines in pancreatic carcinoma: correlation with phenotypic characteristics and prognosis. Cancer 2004; 101:2727–2736.[Medline]
- Kingo K, Ratsep R, Koks S, Karelson M, Silm H, Vasar E. Influence of genetic polymorphisms on interleukin-10 mRNA expression and psoriasis susceptibility. J Dermatol Sci 2005; 37:111–113.[Medline]
- Turner DM, Williams DM, Sankaran D, Lazarus M, Sinnott PJ, Hutchinson IV. An investigation of polymorphism in the interleukin-10 gene promoter. Eur J Immunogenet 1997;24:1–8.[Medline]
- Deans DA, Tan BH, Ross JA, Rose-Zerilli M, Wigmore SJ, Howell WM, Grimble RF, Fearon KC. Cancer cachexia is associated with the IL10-1082 gene promoter polymorphism in patients with gastroesophageal malignancy. Am J Clin Nutr 2009;89:1164–1172.[Abstract/Free Full Text]
- Fearon KC, Voss AC, Hustead DS, Cancer Cachexia Study Group. Definition of cancer cachexia: effect of weight loss, reduced food intake, and systemic inflammation on functional status and prognosis. Am J Clin Nutr 2006;83:1345–1350.[Abstract/Free Full Text]
- Sobin LH, Wittekind C. TNM Classification of Malignant Tumors, 6th ed, Wiley, New York, 2002; pp 52–56.
- Costa GC, da Costa Rocha MO, Moreira PR, Menezes CA, Silva MR., Gollob KJ, Dutra WO. Functional IL-10 gene polymorphism is associated with Chagas disease cardiomyopathy. J Infect Dis 2009;199:451–454.[Abstract/Free Full Text]
- Edwards-Smith CJ, Jonsson JR, Purdie DM, Bansal A, Shorthouse C, Powell EE. Interleukin-10 promoter polymorphism predicts initial response of chronic hepatitis C to interferon alfa. Hepatology 1999;30:526–530.[Medline]
- Krzystek-Korpacka M, Matusiewicz M, Diakowska D, Grabowski K, Blachut K, Kustrzeba-Wojcicka I, Banas T. Impact of weight loss on circulating IL-1, IL-6, IL-8, TNF-
, VEGF-A, VEGF–C and midkine in gastroesophageal cancer patients. Clin Biochem 2007;40: 1353–1360.[Medline] - Ueda T, Shimada E, Urakawa T. Serum levels of cytokines in patients with colorectal cancer: possible involvement of interleukin-6 and interleukin-8 in hematogenous metastasis. J Gastroenterol 1994;29:423–429.[Medline]
- Du R, Pan SY, Lu BX. Allele frequencies of polymorphisms of interleukin-10 promoter in Chinese Han population. Jie Pou Xue Za Zhi 2006;29:686–689.
- Moraes MO, Santos AR, Schonkeren JJ, Vanderborght PR, Ottenhoff TH, Moraes ME, Moraes JR, Sampaio EP, Sarno EN, Huizinga TW. Interleukin-10 promoter haplotypes are differently distributed in the Brazilian versus the Dutch population. Immunogenetics 2003;54:896–899.[Medline]
- Wu MS, Wu CY, Chen CJ, Lin MT, Shun CT, Lin JT. Interleukin-10 genotypes associate with the risk of gastric carcinoma in Taiwanese Chinese. Int J Cancer 2003;104:617–623.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
F. Robert, J. R. Mills, A. Agenor, D. Wang, S. DiMarco, R. Cencic, M. L. Tremblay, I. E. Gallouzi, S. Hekimi, S. S. Wing, et al.
Targeting Protein Synthesis in a Myc/mTOR-Driven Model of Anorexia-Cachexia Syndrome Delays Its Onset and Prolongs Survival
Cancer Res.,
February 1, 2012;
72(3):
747 - 756.
[Abstract]
[Full Text]
[PDF]
|
 |
|