HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Zhang, P. L. Articles by Cheung, J. Y. Search for Related Content PubMed PubMed Citation Articles by Zhang, P. L. Articles by Cheung, J. Y.

Preinduced Molecular Chaperones in the Endoplasmic Reticulum Protect Cardiomyocytes from Lethal Injury

Address correspondence to Ping L. Zhang, M.D., Ph.D., Division of Laboratory Medicine, Geisinger Medical Center, 100 North Academy Ave, Danville, PA 17822, USA; tel 570 271 6333; fax 570 271 6105; e-mail plzhang{at}geisinger.edu.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Acknowledgements References

 
Although molecular chaperones in the endoplasmic reticulum (ER) are known to be involved in folding and assembly of glycosylated proteins, it is unclear whether preinduced ER chaperones can protect cardiomyocytes from lethal injury. In this study we used tunicamycin, an inhibitor of N-linked glycosylation in the ER, to preinduce ER chaperones in H9c2 cardiomyocytes and we tested the cytoprotective role of preinduced ER chaperones in the cardiomyocytes. Expression of GRP78 at both protein and mRNA levels was markedly increased in cardiomyocytes pretreated with tunicamycin, when compared to non-treatment controls. Following prolonged ATP depletion or oxidative stress, which was used to simulate cardiac ischemia and reperfusion injury, respectively, the release of lactate dehydrogenase (LDH) from tunicamycin-pretreated cardiomyocytes was significantly lower than from non-pretreated cardiomycocytes. Tunicamycin-pretreated cardiomyocytes showed significantly higher Ca²⁺ release into cytoplasm than controls when treated with both caffeine and thapsigargin, indicating higher storage of Ca²⁺ in the ER. After oxidative stress, cytosolic Ca²⁺ levels were maintained relatively stable in tunicamycin-pretreated cardiomyocytes, when compared to control cardiomyocytes. These observations suggest that preinduced ER chaperones protect cardiomyocytes from lethal injury, at least in part, by preventing an increase in cytosolic Ca²⁺.

(received 26 May 2004; accepted 29 June 2004)

Keywords: endoplasmic reticulum, glucose regulated proteins, cytoprotection, cardiomyocytes, oxidative stress

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Acknowledgements References

 
Preconditioning cytoprotection has been extensively studied for two decades [1,2]. Although there are many proposed mechanisms, 2 major groups of intracellular molecular chaperones, located within the cytoplasm and the ER, respectively, appear to be involved in the preconditioning phenomenon. Cytosolic molecular chaperones are also known as heat shock proteins (HSP), since they were initially identified following the exposure of cells to high temperature [3]. Glucose regulated proteins (GRP), which are ER molecular chaperones, are so termed because glucose deficient medium was initially found to induce GRP in cell culture [4]. Under non-stressful conditions, both HSP and GRP are involved in the folding, assembly, and transport of newly synthesized proteins [3]. In response to cellular stress, such as ischemia or toxic injury, these chaperones are usually over-expressed and are believed to bind to misfolded proteins, preventing them from aggregating and being degraded [5].

Studies on transgenic mice that overexpress HSP70, a cytosolic molecular chaperone, have demonstrated that this protein confers myocardial protection against ischemia-reperfusion injury [6,7]. In addition, in vitro up-regulation of HSP70 in cultured cells increases the tolerance of cardiac myocytes to subsequent oxidative injury [8]. The cytoprotective role of GRP in cardiac myocytes has not been investigated, although overexpressed GRP in cultured renal and neural cells has been shown to enhance cellular tolerance to ischemic, toxic, and oxidative insults [9–12].

The mechanism for ER chaperone-associated cytoprotection is unclear. The protection can result from stabilizing unfolded ER proteins or preventing release of Ca²⁺ from the ER into the cytoplasm [9,10]. Since accumulation of cytosolic Ca²⁺ ([Ca²⁺]in) is believed to be the major factor triggering cell death [13,14], we hypothesize that preinduced ER chaperones can buffer more Ca²⁺ in the ER and maintain a relatively stable level of [Ca²⁺]in in the presence of insults.

In this study we induced GRP78 with Ca²⁺-binding capacity. Then we assessed the cytoprotective role of preinduced ER chaperones in H9c2 cardiomyocytes subjected to prolong ATP depletion or oxidative stress induced by hydrogen peroxide (H₂O₂), mimicking a state of cardiac ischemia and reperfusion injury.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Acknowledgements References

 
Materials.  Rabbit anti-GRP78 antibody was purchased from StressGen Biotechnologies Corp (Victoria, BC, Canada). Rabbit anti-calsequestrin antibody was purchased from Swant (Bellinzona, Switzerland). Tunicamycin was purchased from Calbiochem (La Jolla, CA). Antimycin A and H₂O₂ were purchased from Sigma (St Louis, MO). ATP assay kits were purchased from Roche Molecular Biochemicals (Indianapolis, IN).

Cell cultures.  H9c2 cardiomyocytes isolated from rat myocardium were purchased from the American Type Culture Collection (Rockville, MD). They were continuously maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco-BRL, Gaithersburg, MD) supplemented with 10% fetal bovine serum (FBS) and antibiotics in an atmosphere of 95% air and 5% CO₂.

Pre-treatment of H9c2 cells with tunicamycin and challenged with ATP depletion or oxidative stress.  Confluent monolayers of H9c2 myocytes in DMEM containing 10% heat-inactivated FBS were rinsed with phosphate buffered saline (PBS) twice and then incubated for 16 hr with or without tunicamycin (10 and 100 nM). H9c2 myocytes were then treated with or without 10 µM antimycin A (oxidative-phosphorylation inhibitor) in PBS with 1.5 mM CaCl₂ and 2 mM MgCl₂ for 5 hr to deplete ATP, or with 50 to 100 mM H₂O₂ in culture medium for 1 hr to induce oxidative stress. Intracellular ATP concentrations were determined for each group using a Bioluminescence Assay Kit (Sigma).

Western blots.  Confluent H9c2 cardiac myocytes were treated with tunicamycin (10 and 100 nM) for 16 hr. Cells were harvested and sonicated. Cell homogenates, at 50 µg total protein per lane, were electrophoresed on 7–12% SDS PAGE. Fractionated proteins were transferred onto nitrocellulose membranes. For immunostaining of GRP78, rabbit anti-GRP78 antibody (1:2,000 dilution) was used. The second antibody was anti-rabbit horseradish peroxidase-linked whole antibody (from donkey) (1:2,000 dilution). Immunoreactive proteins were visualized by an enhanced chemiluminescence-Western blotting system (Amersham Phamacia Biotech, Piscataway, NJ). Immunostaining of calsequestrin (1:2,000 dilution) was performed as described above, using respective primary and secondary antibodies. Each experiment was repeated at least 3 times.

Real Time PCR.  Total RNA was isolated from untreated and tunicamycin-treated H9c2 cells using RNA zol-B isolation kit (Tel-Test, Inc, Friendswood, TX) according to the manufacturer’s instructions. To remove possible genomic DNA contaminants, 2 µg of total RNA from each sample was treated with 2 U of RNAse-free deoxyribonuclease I (Invitrogen, Carlsbad, CA). One µg of purified RNA from each sample was reverse transcribed to cDNA using Taqman reverse transcriptase kit with random hexamers according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA). No enzyme was added for the reverse–transcriptase-negative controls. The resulting cDNA was diluted to a final concentration of 10 ng/µl and frozen at –20°C until further use. The GRP78 primer/TaqMan probe was designed based on the sequence in the first exon of rat GRP78 gene (GenBank accession #M14866) using Primer Express Software (Applied Biosystems). The sequences of the probe and primers were:

TaqMan Probe:

(FAM)-AGCGACTGACTGGTCCACAGCGC-(TAMRA);

ForwardPrimer:

TTGCTGGACTCTGTGAGACACC; and

Reverse primer:

CGCCACCACAGTGAACTTCA.

The probes, primers, reagents, and buffers were all purchased from Applied Biosystems. PCR amplification of GRP78 was carried out in a total volume of 50 µl containing 50 ng of template cDNA, 25 µl of universal Master Mix buffer, 400 nM forward and reverse primers, and 200 nM TaqMan probe. To account for differences in starting cDNA samples, the 20x pre-developed 18s rRNA reagents were used according to manufacturer’s instructions. The GRP78 and 18s rRNA PCR reactions were run in separate tubes in duplicate on an ABI prism 7700 Sequence detector. The thermal cycling conditions consisted of 2 min at 50°C and 10 min at 95°C, followed by 40 cycles at 95°C for 15 sec and 60°C for 60 sec. RT-negative control and template-free control were included in each assay. Data were analyzed by Sequence Detector Software. The mean threshold cycle (Ct) value was calculated from the duplicates of each cDNA sample.

The relative differences in GRP78 gene expression between the tunicamycin-treated and untreated groups were determined using a comparative C_T method. The C_T values of the GRP78 were normalized by subtracting the C_T value for the 18s rRNA, yielding a C_T value for each sample. Subtracting the C_T for the untreated group from that of the treated group yields a C_T value that can be directly converted to a fold-increase over the untreated control group.

Lactate dehydrogenase (LDH) and cell viability assays.  Confluent monolayers of H9c2 cells growing in 96-well plates were incubated in the presence or absence of stress protein-inducing agents for 16 hr and subsequently subjected to ATP depletion or oxidative stress. LDH levels in the medium were measured before and after the ATP depletion or hydrogen peroxide treatment using the Cytotox 96 non-radioactive cytotoxicity assay (Promega, Madison, WI). Quantification of LDH content was performed on a microtiter plate reader at 490 nm. The amount of LDH released into the culture supernatant was calculated from a standard curve. To determine cell viability, 100 µl of serum-free medium were added to cells in each well. Then, 20 µl of One-Step Assay Solution (CellTiter 96 one solution proliferation assay, Promega, Madison, WI) containing tetrazolium was added to each well. The tetrazolium compound can be bioreduced by viable cells to form colored formazan product soluble in culture medium. After incubation for 30 min, numbers of viable cells were determined by measuring absorbance at 490 nm using a microtiter plate reader.

Measurement of [Ca²⁺]in.  Cardiomyocytes grown on glass coverslips were exposed to 1.34 mM fura-2 acetoxymethyl ester for 20 min at 37°C. Fura-2 loaded myocytes were mounted in a Dvorak-Stotler chamber situated in a temperature-controlled stage (37°C) of a Zeiss IM35 inverted microscope. Epifluoresence (510 ± 18 nm) collected by an Olympus Dapo UV X 40/1.3 numerical aperature oil objective was passed through a pinhole (1.6 mm) and captured by a photomultiplier. Signal from the photomultiplier was routed through an amplifier/discriminator (model C609, Thorn EMI, Middlesex, UK) before arrival at a counter/timer board (model C660, Thorn EMI). Epifluorescence from a myocyte collected at 360-nm excitation was divided by that collected at 380-nm excitation to obtain the fluorescence intensity ratio (R), from which [Ca²⁺]in was calculated by using 224 nM as the Ca²⁺-fura 2 dissociation constant [15,16].

Statistics.  Results are reported as mean ± SEM. Significance of multiple comparisons was determined by ANOVA followed by a Bonferroni/Dunn test. A p value of <0.05 was considered significant.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Acknowledgements References

 
Effects of tunicamycin on GRP78.  Protein expression of GRP78 was significantly increased in tunicamycin-treated cardiomyocytes (10 nM tunicamycin, 189 ± 11 Arbitrary Units (AU) and 100 nM tunicamycin, 186 ± 28 AU), when compared to control cardiomyocytes (100 ± 0 AU) (Fig. 1, upper panel) (n = 3 in each group). By contrast, calsequestrin, a major protein for Ca²⁺ binding in the ER, did not change following tunicamycin treatment (data not shown). The real time PCR study showed that mRNA expression of GRP78 increased up to 33-fold in cardiomyocytes treated with tunicamycin, when compared to control myocytes (Fig. 1, lower panel and Table 1).

View larger version (29K): [in this window] [in a new window]   Fig. 1. Upper panel. Tunicamycin-induced ER chaperones in H9c2 myocytes. Western blot analysis of total protein from H9c2 myocytes treated for 16 hr in the absence (control) or presence of tunicamycin at 10 nM (T10) and 100 nM (T100). The Western blot revealed that pre-treatment with tunicamycin for 16 hr led to overexpression of GRP78 in a dose-dependent manner, but there was no change in expression of calsequestrin in H9c2 myocytes (data not shown). This experiment was repeated 3 times with similar results. Lower panel. Real time PCR to detect GRP78 mRNA in the control group (B) and the tunicamycin-treated group (A). The tunicamycin-treated group showed the threshold of cycle (CT) for GRP78 at PCR cycle 17, whereas the control did not exhibit the CT for GRP78 until PCR cycle 22. Final induction of GRP78 mRNA in the 2 groups is listed in Table 1. Delta Rn = reduced normalized fluorescence values. CT is indicated by a solid line at the center of the graph.

View larger version (28K): [in this window] [in a new window]   Fig. 2. Upper panel. ATP levels in medium, PBS, antimycin A and tunicamycin plus antimycin A groups (n = 4 in each group). Lower panel. LDH levels in supernatants in control and tunicamycin treated groups, after ATP depletion by antimycin A for 5 hr (n = 5 in each group). * = p <0.05.

View larger version (29K): [in this window] [in a new window]   Fig. 3. LDH release (upper panel) and viable cell number (lower panel) of H9c2 myocytes subjective to 50 µM of hydrogen peroxide in both control and tunicamycin-pretreated groups (n = 5 in each group). * = p <0.05.

View larger version (28K): [in this window] [in a new window]   Fig. 4. Upper panel. Subjected to 5 mM of caffeine and 1 µM of thapsigargin, mean level of [Ca2+]in increased in non-tunicamycin (T) treated control cells and tunicamycin (10 nM) pretreated myocytes, followed by a gradual [Ca2+]in decrease over 20 min. Lower panel. The mean peak level in [Ca2+]in was significantly higher in tunicamycin-pretreated myocytes (n = 12) than control myocytes (n = 15). * = p <0.05.

View larger version (18K): [in this window] [in a new window]   Fig. 5. Subjected to 120 µM of H2O2 for 1 hr, [Ca2+]in increased dramatically in non-tunicamycin (T) treated control cells (n = 12), but not in tunicamycin (10 nM) pretreated myocytes (n = 12). * = p <0.05.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Acknowledgements References

The current data showed that tunicamycin treatment resulted in protein overexpression of GRP78 in H9c2 cardiomyocytes. Real time PCR revealed a quantitative increase in GRP78 mRNA up to 33-fold in tunicamycin-treated cardiomyocytes. The data are consistent with our previous findings in cultured renal cells [9,19].

Although preinduced cytoplasmic chaperones (heat shock proteins) have been well documented to protect cardiomyocytes from lethal injury in vitro and in vivo [6–8], our current data provide the first evidence that preinduced ER chaperones protect cardiomyocytes from both energy depletion and oxidative stress. Several studies have reported that ER chaperones are critical for cellular survival in non-cardiac cells under a lethal stress. In a Chinese hamster ovary cell line, GRP78 antisense transcripts resulted in increased toxicity to A23187 [GenBank] and chronic hypoxia [20,21]. Similarly, GRP78 antisense in cultured renal and neural cell lines was also responsible for a reduced survival capacity when subjected to toxic stress [10,22]. By contrast, preinduction of ER chaperones such as GRP78 and calreticulin were associated with less damage in renal cells subjected to prolonged ATP depletion and various toxic insults [9–11]. Preinduced protein-disulfide isomerase, an ER chaperone, protected primary astrocytes from hypoxic injury [12]. These investigators also demonstrated reduced brain damage in an area overexpressing protein-disulfide isomerase in response to brain ischemia in rats [12]. Taken together, preconditionally induced molecular chaperones, either in the cytoplasm or the ER, play an important role in cytoprotection from subsequent injury.

A major function of ER chaperones is to promote maturation of newly synthesized proteins to functional units. When ER chaperones are upregulated, they bind to more unfolded proteins [19,23]. This feature of upregulated ER chaperones has been proposed as a potential mechanism for their preconditioning cytoprotection [9], although as yet there is no evidence to support this suggestion. A similar speculation was proposed for the cytoprotective effects of preinduced cytoplasmic chaperones [6–8], but neither has this been proven experimentally.

In contrast to cytosolic chaperones, ER chaperones have a large capacity to bind Ca²⁺ and are possibly involved in regulation of Ca²⁺ homeostasis. At resting level, there are about 600 mM of Ca²⁺ in the ER, but only approximately 100 nM of Ca²⁺ are present in the cytoplasm. Therefore, ER provides a large reservoir for Ca²⁺ storage [24,25]. Ca²⁺ from the ER is released into cytoplasm mainly via ryano-dine receptors on the ER membranes of cardiomyocytes, whereas it is taken back to the ER by sarco-(endo)plasmic reticulum Ca²⁺ ATPase (SERCA) [24,25]. In the ER, other than the high capacity Ca²⁺-binding protein, calsequestrin, GRP78 can bind up to 25% of calcium under resting conditions [26]. The P domain of calreticulin can bind Ca²⁺ with high affinity and low capacity, whereas the C domain region of the protein binds Ca²⁺ with low affinity and high capacity [25,26]. Upon the stimulation of caffeine for releasing Ca²⁺ into cytoplasm and blockade of Ca²⁺ uptake by thapsigargin, our data showed a significantly high peak Ca²⁺ level in the cytoplasm of tunicamycin-pretreated cardiomyocytes. This finding indicates that tunicamycin-pretreated cardiomyocytes can store more Ca²⁺ in the ER. Since calsequestrin remained unchanged while ER chaperones were upregulated after tunicamycin treatment, more Ca²⁺ in the ER most likely resulted from binding sites of the overexpressed ER chaperones being more available. Our data are consistent with reports that transfected non-cardiac cells overexpressing GRP78 or calreticulin showed higher release of calcium into the cytoplasm, when subjected to ER Ca²⁺ depletion or varying ER stimulation [26–28].

The enhanced capacity of overexpressed ER chaperones to store ER Ca²⁺ may be associated with a relatively stable level of cytosolic Ca²⁺ in tunica-mycin-pretreated cardiomyocytes subjected to oxidative stress, as observed in the present study. This observation is similar to the findings in cultured renal cells [10]. The P domain of calreticulin has been regarded as a structure to interact with Ca²⁺ release receptors and SERCA for regulation of Ca²⁺ and SERCA2b has been reported to be upregulated in tunicamycin-treated PC12 cells [27,29,30]. Upregulated ER chaperones, therefore, appear to regulate [Ca²⁺]in by active interaction with receptors for uptaking Ca²⁺, in addition serving as a "sink" for otherwise toxic Ca²⁺ concentrations in the cytoplasm that develop following H₂O₂ stress.

Oxidative stress can cause an increase in [Ca²⁺] in from several sources, such as mitochondrial Ca²⁺([Ca²⁺]M), released Ca²⁺ from Ca²⁺-binding proteins along the cell membranes, or by inactivating plasma membrane Ca²⁺-ATPase [21,32]. Accumulated [Ca²⁺]in, in turn, promotes the increase in [Ca²⁺]M with subsequent production of reactive oxidative species from mitochondria, which causes intracellular damage and cell death [33,34]. With oxidative stress, chelating [Ca²⁺]in by BAPTA prevents increases in [Ca²⁺]M and mitochondrial permeability, and loss of mitochondrial membrane potential, a pathway leading to mixed pattern of cell death, apoptosis and necrosis of neonatal cardiomyocytes [33]. It appears that keeping stable [Ca²⁺]in, by preinduced ER chaperones, may prevent accumulation [Ca²⁺]M, thus reducing cell death. Since there may be mutual talk between [Ca²⁺]M and Ca²⁺ in the ER [28,35,36], we can not exclude the possibility that preinduced ER chaperones have more direct effects on lowering [Ca²⁺]M and cell death under oxidative stress.

In summary, GRP78 (at both mRNA and protein levels) was significantly upregulated following tunicamycin treatment. This may be a key factor responsible for both the increased calcium release when subjected to both caffeine and thapsigargin treatment and for maintaining a relatively normal level of [Ca²⁺]in when exposed to oxidative challenge. These characteristics of over-expressed ER chaperones may provide a plausible mechanism for the preconditioning cytoprotection of H9c2 cardiomyocytes pretreated with tunicamycin.

	Acknowledgements

Top Abstract Introduction Materials and Methods Results Discussion Acknowledgements References

 
We thank Dr. Xue-Qian Zhang, Ms. Lois L. Carl, Dr. William J. Russell, Ms. Lu P. Zheng, and Mr. John H. Shaw IV for technical assistance. This work was supported in part by American Heart Association Grant 0365537U to P. L. Zhang.

	References

Top Abstract Introduction Materials and Methods Results Discussion Acknowledgements References

 

1. Bolli R. Cardioprotective function of inducible nitric oxide synthase and role of nitric oxide in myocardial ischemia and preconditioning: an overview of a decade of research. J Mol Cell Cardiol 2001;33:1897–1918.[Medline]
2. Yellon DM, Downey JM. Spotlight on preconditioning. Cardio Res 2002;55: 425–428.
3. Welch W. Mammalian stress responses: cell physiology, structure/function of stress proteins, and implications for medicine and disease. Physiol Rev 1992;72:1063–1081.[Free Full Text]
4. Shiu RPC, Pouyssegur J, Pastan I. Glucose depletion accounts for the induction of two transformation-sensitive membrane proteins in Rous sarcoma virus-transformed thick embryo fibroblasts. PNAS USA 1977;74:3840–3844.[Abstract/Free Full Text]
5. Crag E, Weissman J, Horwich A. Heat shock proteins and molecular chaperones: mediators of protein conformation and turnover in the cell. Cell 1994;78:365–372.[Medline]
6. Marber MS, Mestril R, Chi SH, Sayen MR, Yellon DM, Dillmann WH. Overexpression of the rat inducible 70-kD heat stress protein in a transgenic mouse increases the resistance of the heart to ischemic injury. J Clin Invest 1995;95:1446–1456.
7. Trost SU, Omens JH, Karlon WJ, Meyer M, Mestril R, Covell JW, Dillmann WH. Protection against myocardial dysfunction after a brief ischemic period in transgenic mice expressing inducible heat shock proteins 70. J Clin Invest 1998;101:855–862.[Medline]
8. Chong KY, Lai CC, Lille S, Chang C, Su CY. Stable overexpression of the constitutive form of heat shock protein 70 confers oxidative protection. J Mol Cell Cardiol 1998;30:599–608.[Medline]
9. Bush KT, George SK, Zhang PL, Nigam SK. Pretreatment with inducers of ER molecular chaperones protects epithelial cells subjected to ATP depletion. Am J Physiol 1999;277:F211–F218
10. Liu H, Bowes RC, van de Water B, Sillence C, Nagelkerke JF, Stevens JL. Endoplasmic reticulum chaperones GRP78 and calreticulin prevent oxidative stress, Ca²⁺ disturbances, and cell death in renal epithelial cells. J Biol Chem 1997;272:21751–21759.[Abstract/Free Full Text]
11. Tanaka S, Uehara T, Nomura Y. Up-regulation of protein-disulfide isomerase in response to hypoxia/brain ischemia and its protective effect against apoptotic cell death. J Biol Chem 2000;275:10388–10393.[Abstract/Free Full Text]
12. Liu H, Miller E, van de Water B, Stevens JL. Endoplasmic reticulum stress proteins block oxidant-induced Ca²⁺ increase and cell death. J Biol Chem 1998;273:12858–12862.[Abstract/Free Full Text]
13. Singal PK, Khaper N, Palace V, Kumar D. The role of oxidative stress in the genesis of heart disease. Cardio Res 1998;40:426–432.
14. Theroux P. Protection of the myocardial cell during ischemia. Am J Cardiol 1999;83(10A):3G–9G.[Medline]
15. Zhang X-Q, Song J, Carl LL, Shi W, Qureshi A, Tian Q, Chung JY. Effects of spring training on contractility and [Ca²⁺]_i transients in adult rat myocytes. J Appl Physiol 2002;93:1310–1317.[Abstract/Free Full Text]
16. Zhang XQ, Ng YC, Moore RL, Musch TI, Cheung JY. In situ SR function in postinfarction myocytes. J Appl Physiol 1999;87:2143–2150.[Abstract/Free Full Text]
17. Kaufman RJ. Stress signaling from the lumen of the endoplasmic reticulum: coordination of gene transcriptional and translational controls. Genes Dev 1999;13: 1211–1233.[Free Full Text]
18. Mori K. Tripartite management of unfolded proteins in the endoplasmic reticulum. Cell 2000;101:451–454.[Medline]
19. Kuznetsov G, Bush KT, Zhang PL, Nigam SK. Perturbations in maturation of secretory proteins and their association with endoplasmic reticulum chaperones in a cell culture model for epithelial ischemia. PNAS USA 1996;93:8584–8589.[Abstract/Free Full Text]
20. Koong AC, Chen EY, Lee AS, Brown JM, Giaccia AJ. Increased cytotoxicity of chronic hypoxic cells by molecular inhibition of GRP78 induction. Int J Radiation Oncology Biol Phys 1994;28:661–666.[Medline]
21. Li L, Li X, Ferrario A, Rucker N, Liu E, Wong S, Gomer CJ, Lee AS. Establishment of a Chinese hamster ovary cell line that expresses grp78 antisense transcripts and suppresses A23187 [GenBank] induction of both GRP78 and GRP94. J Cell Physiol 1992;153:575–582.[Medline]
22. Yu Z, Luo H, Fu W, Mattson MP. The endoplasmic reticulum stress-responsive proteins GRP78 protects neurons against exocitotoxicity and apoptosis: suppression of stress and stabilization of calcium homeostasis. Exper Neurol 1999;155:302–314.[Medline]
23. Kuznetsov G, Nigam SK. Folding of secretory and membrane proteins. N Engl J Med 1998;339:1688–1695.[Medline]
24. Corbett EF, Michalak M. Calcium, a signaling molecule in the endoplastic reticulum. Trends Bio Sci 2000;25:307–311.
25. Meldolesi J, Pozzan T. The endoplasmic reticulum Ca²⁺ store: a view from the lumen. Trends Bio Sci 1998;23:10–14.
26. Lièvremont J, Rizzuto R, Hendershort L, Meldolesi J. Bip, a major chaperone protein of the endoplasmic reticulum lumen, plays a direct and important role in the storage of the rapidly exchanging pool of Ca²⁺. J Biol Chem 1997;272: 30873–30879.[Abstract/Free Full Text]
27. Mery L, Mesaeli N, Michalak M, Opas M, Lew DP, Krause K. Overexpression of calreticulin increases intracellular Ca²⁺ storage and decreases store-operated Ca²⁺ influx. J Bio Chem 1996;271:9332–9339.[Abstract/Free Full Text]
28. Arnaudeau S, Frieden M, Nakamura K, Castelbou C, Michalak M, Demaurex N. Calreticulin differentially modulates calcium uptake and release in the endoplasmic reticulum and mitochondria. J Biol Chem 2002;277: 46696–46705.[Abstract/Free Full Text]
29. John LM, Lechleiter JD, Camacho P. Differential modulation of SERCA2 isoform by calreticulin. J Cell Biol 1998; 142:963–973.[Abstract/Free Full Text]
30. Caspersen C, Sten Pedersen P, Treiman M. The sarco/endoplasmic reticulum calcium-ATPase 2b is an endoplasmic reticulum stress-inducible protein. J Biol Chem 2000;275:22363–22372.[Abstract/Free Full Text]
31. Hoyal CR, Thomas AP, Forman HJ. Hydroperoxide-induced increases in intracellular calcium due to annexin VI translocation and inactivation of plasma membrane Ca²⁺-ATPase. J Biol Chem 1996;46:29205–29210.
32. Somlyo AP, Bond M, Somlyo AV. Calcium content of mitochondria and endoplasmic reticulum in liver frozen rapidly in vivo. Nature 1985;314:622–625.[Medline]
33. Van de Water B, Zoeteweij JP, de Bont HJGM, Mulder GJ, Nagelkerke JF. Role of mitochondrial Ca²⁺ in the oxidative stress-induced dissipation of the mitochondrial membrane potential. J Bio Chem 1994;269:14546–14552.[Abstract/Free Full Text]
34. Akao M, O’Rourke B, Teshima Y, Seharaseyon J, Marban E. Mechanistically disctinct steps in mitochondrial death pathway triggered by oxidative stress in cardiac myocytes. Circ Res 2003;92:186–194.[Abstract/Free Full Text]
35. Arnaudeau S, Kelley WL, Walsh JV, Demaurex N. Mitochondria recycle Ca²⁺ to the endoplasmic reticulum and prevent the depletion of neighboring endoplasmic reticulum regions. J Biol Chem 2001;276:29430–29439.[Abstract/Free Full Text]
36. Scorrano L, Oakes SA, Opferman JT, Cheng EH, Sorcinelli MD, Pozzan T, Korsmeyer SJ. BAX and BAK regulation of endoplasmic reticulum Ca²⁺: a control point for apoptosis. Science 2003;300:135–139.[Abstract/Free Full Text]

This article has been cited by other articles:

				P. E. Kolattukudy and J. Niu Inflammation, Endoplasmic Reticulum Stress, Autophagy, and the Monocyte Chemoattractant Protein-1/CCR2 Pathway Circ. Res., January 6, 2012; 110(1): 174 - 189. [Abstract] [Full Text] [PDF]

				M. S. Willis, W. H. D. Townley-Tilson, E. Y. Kang, J. W. Homeister, and C. Patterson Sent to Destroy: The Ubiquitin Proteasome System Regulates Cell Signaling and Protein Quality Control in Cardiovascular Development and Disease Circ. Res., February 19, 2010; 106(3): 463 - 478. [Abstract] [Full Text] [PDF]

				D. J. Thuerauf, M. Marcinko, N. Gude, M. Rubio, M. A. Sussman, and C. C. Glembotski Activation of the Unfolded Protein Response in Infarcted Mouse Heart and Hypoxic Cultured Cardiac Myocytes Circ. Res., August 4, 2006; 99(3): 275 - 282. [Abstract] [Full Text] [PDF]

				J. J. Martindale, R. Fernandez, D. Thuerauf, R. Whittaker, N. Gude, M. A. Sussman, and C. C. Glembotski Endoplasmic Reticulum Stress Gene Induction and Protection From Ischemia/Reperfusion Injury in the Hearts of Transgenic Mice With a Tamoxifen-Regulated Form of ATF6 Circ. Res., May 12, 2006; 98(9): 1186 - 1193. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Zhang, P. L. Articles by Cheung, J. Y. Search for Related Content PubMed PubMed Citation Articles by Zhang, P. L. Articles by Cheung, J. Y.