ACLS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ji, Q.
Right arrow Articles by Xu, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ji, Q.
Right arrow Articles by Xu, J.
Annals of Clinical & Laboratory Science 34:427-436 (2004)
© 2004 Association of Clinical Scientists

Pentoxifylline Inhibits Endotoxin-Induced NF-kappa B Activation and Associated Production of Proinflammatory Cytokines

Qing Ji, Lidong Zhang, Hongbin Jia, Jianjun Yang and Jianguo Xu
Department of Anesthesiology, Jinling Hospital, Nanjing, People’s Republic of China

Address correspondence to Jianguo Xu, M.D.; Department of Anesthesiology, Jinling Hospital, 305 East Zhongshan Road, Nanjing 210002, People’s Republic of China; tel 86 25 8480 6839; fax 86 25 8480 6839; e-mail: jiqing73{at}sina.com.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The effects of graded doses of pentoxifylline (PTX) on endotoxin-induced production of inflammatory cytokines and activation of nuclear factor kappa B (NF-{kappa}B) were studied in vivo in rat intestine. Sepsis was induced in rats by ip injection of lipopolysaccharide (LPS, 5 mg/kg). PTX was injected via the tail vein at dosages of 6.25, 12.5, 25, 50, or 100 mg/kg at 1 min after LPS challenge. NF-{kappa}B activation in intestine was investigated by electrophoretic mobility shift assay (EMSA). Tumor necrosis factor-alpha (TNF-{alpha}), interleukin-6 (IL-6), and interleukin-10 (IL-10) levels were measured in intestine by enzyme-linked immunosorbance assays (ELISA). Intestinal TNF-{alpha}, IL-6, and IL-10 mRNA expression were studied by the reverse-transcription polymerase chain reaction (RT-PCR). The measurements of NF-{kappa} B, TNF-{alpha}, IL-6, and IL-10 were performed, respectively, at 1, 4, 4, and 1 hr after endotoxin injection. The results showed that LPS elevated the production of TNF-{alpha}, IL-6, and IL-10 and enhanced NF-{kappa}B activation in rat intestine. At all dosages, PTX reduced the activation of NF-{kappa}B and the production of TNF-{alpha} and IL-6, but enhanced the release of IL-10. These effects were greatest at dosages of 50 mg/kg for TNF-{alpha} and IL-6, and 25 mg/kg for IL-10. In conclusion, PTX suppressed the production of proinflammatory cytokines such as TNF-{alpha} and IL-6 in rat intestine, and enhanced the endotoxin-induced production of IL-10. The suppressive effect of proinflammatory cytokines may act by inhibiting NF-{kappa}B activation, but not by induction of IL-10.

(received 21 July 2004; accepted 8 September 2004)

Keywords: pentoxifylline, NF-{kappa}B, TNF-{alpha}, interleukin-6, interleukin-10


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Gram-negative sepsis is the major cause of death in critically ill patients [1–4]. Lipopolysaccharide (LPS), or endotoxin, a major constituent of the outer wall of Gram-negative bacteria, is believed to trigger this systemic inflammatory response [5–8]. Many drugs with anti-inflammatory properties have been evaluated for ability to inhibit this inflammatory cascade.

Pentoxifylline (PTX), a methylxanthine derivative, has been used to treat vascular diseases [9]. PTX has been reported to suppress the production of tumor necrosis factor-alpha (TNF-{alpha}) [10] and modulate the production of other inflammatory cytokines, such as IL-6, IL-1, and IL-12 [11–13]. The effects of PTX on the production of inflammatory cytokines have mostly been studied in vitro. The reported results have varied widely, depending on the cell types studied, PTX dosage, and timing of PTX administration [14]. Few studies have investigated the protective effect of PTX on inflammatory responses in vivo, even though locally produced cytokines contribute to tissue damage during sepsis [15–16]. Therefore, in this study, we performed experiments in vivo to assess the anti-inflammatory effects of PTX during septic shock.

We chose to study the effect of PTX on cytokine production in intestine because the intestine plays an important role in the inflammatory and metabolic responses to sepsis. Intestinal mucosa, a complex tissue with numerous cell types, is an important source of cytokines during inflammation. The mucosa also produces acute phase proteins, gut hormones, and unidentified substances that affect the intestine locally and influence remote organs and tissues [17–22]. The loss of mucosal integrity often results in increased permeability and bacterial translocation [23]. Some researchers have proposed that the gut mucosa may be partly responsible for multiple organ failure in critical illnesses [24–26].

We investigated whether PTX can suppress the endotoxin-induced production of proinflammatory cytokines, TNF-{alpha} and IL-6, in intestine. Special attention was paid to the effect of PTX on nuclear factor kappa B (NF-{kappa}B) activation since NF-{kappa}B is an inducible transcription factor for TNF-{alpha}, IL-6, and IL-8 [27]. The effect of PTX on IL-10 induction was included since previous studies showed that IL-10 release is related to TNF-{alpha} production [28–29].


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Experimental animals and procedures.  Male Wistar rats were purchased from the Animal Center of the Chinese Academy of Science (Shanghai, China), and were randomly assigned to experimental groups. All procedures were reviewed and approved by the Institutional Animal Care Committee. The rats were housed at 23 ± 1°C in plastic cages, fed food and water ad libitum for 7 days, and used for experiments when their body weights reached 250–300 g. The rats were anesthetized with urethane (1 g/kg body weight, ip). The Wistar rat sepsis model was induced by injection of LPS (5 mg/kg, ip)(E. coli O111:B4, Sigma Chemical Co, St Louis, MO,USA). Five min later, the animals were treated with PTX (Ratio-pharm Gmbh, Germany; 6.25, 12.5, 25, 50, or 100 mg/kg, iv), or normal saline, by injection into the dorsal tail vein. After 1, 4, or 6 hr, animals were killed, and tissues from the intestine (jejunum) were removed and stored in liquid nitrogen for later assay. There were 6 rats in every group at each time point.

Nuclear protein extract.  Nuclear extracts of the intestine tissue were prepared by hypotonic lysis followed by high salt extraction as described previously [30]. In brief, ~0.1 g of frozen tissue was homogenized in 0.8 ml of ice-cold buffer A, composed of 10 mM HEPES (pH 7.9), 10 mM KCl, 2mM MgCl2, 0.1 mM EDTA, 1.0 mM dithio-threitol (DTT), and 0.5 mM phenylmethyl-sulfonylfluoride (PMSF) (all from Sigma Chemical Co). The homogenate was incubated on ice for 20 min, after which 50 ml of 10% Nonidet P-40 solution was added (Sigma Chemical Co); the mixture was vortexed for 30 sec and centrifuged (1 min, 5000 x g, 4°C). The crude nuclear pellet was resuspended in 200 µl of buffer B, containing 20 mM HEPES (pH 7.9), 420 mM NaCl, 1.5 mM MgCl2, 0.1 mM EDTA, 1mM DTT, 0.5 mM PMSF, 25% (v/v) glycerol, and incubated on ice for 30 min with intermittent mixing. After centrifugation (12,000 x g, 4 °C, 15 min), the supernatants were collected as nuclear extracts and stored at –70°C for later use. Protein concentration was determined by the Bradford protein assay.

Electrophoretic mobility shift assay.  EMSA was performed using a commercial kit (Gel Shift Assay System; Promega, Madison, WI, USA) as previously described. The NF-{kappa}B oligonucleotide probe (5'- AGTTGAGGGGACTTTCCCAGGC-3') was end-labeled with [{gamma}-32P] ATP (Free Biotech, Beijing, China) with T4-polynucleotide kinase. Nuclear protein (80 µg) was preincubated in 9 ml of binding buffer, consisting of 10 mM Tris-Cl, pH 7.5, 1 mM MgCl2, 50 mM NaCl, 0.5 mM EDTA, 0.5 mM DTT, 4% glycerol, and 0.05 g/L of polydeoxyinosinic-deoxycytidylic acid for 15 min at room temperature. After addition of 1 µl of 32P-labeled oligonuleotide probe, incubation was continued for 30 min at room temperature. Reaction was stopped by adding 1 µl of gel loading buffer, and the mixture was subjected to non-denaturing 4% polyacrylamide gel electrophoresis in 0.5x TBE buffer. The gel was vacuum-dried and exposed to X-ray film (Fuji Hyperfilm, Japan) at –70°C with an intensifying screen.

Enzyme-linked immunosorbent assay (ELISA).  TNF-{alpha}, IL-6, and IL-10 were assayed in the intestine using commercial ELISA kits specific for the rat cytokines according to the manufacturer’s instructions (Diaclone, Besancon, France for TNF-{alpha}; Biosource International Inc, Camarillo, CA, USA, for IL-6 and IL -10). Values were expressed as pg/mg protein.

Reverse-transcription polymerase chain reaction (RT-PCR).  Total RNA was extracted with TriPure Isolation Reagent (Roche Molecular Biochemicals, Switzerland) and quantified by absorption at 260 nm. Reverse-transcription (RT) was implemented using Reverse Transcription System (Promega, WI, USA) according to the manufacturer’s protocol. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the normalization control.

The sequences of the PCR primers were: TNF-{alpha}

(sense)CACCACGCTCTTCTGTCTACTGAAC, (antisense) CCGGACTCCGTGATGTCTAAGTACT;

IL-6

(sense)GACTGATGTTGTTGACAGCCACTGC, (antisense) TAGCCACTCCTTCTGTGACTCTAACT;

IL-10

sense)TCCTTAATGCAGGACTTTAAGGGTTACTTG, (antisense)GACACCTTGGTCTTGGAGCTTATTAAAATC;

GAPDH

(sense) CACGGCAAGTTCAATGGCACA, (antisense)GAATTGTGAGGGAGAGTGCTC.

A total volume of 100 µl reaction contained 2 µl of RT product, 1.5 mmol/L MgCl2, 2.5 U Taq DNA polymerase, 100 µmol/L dNTP, 0.1 µmol/L primer, and 1x Taq DNA polymerase magnesium-free buffer (Promega, WI, USA). The reaction mixture was overlaid with two drops of mineral oil (Sigma Chemical Co) and incubated in thermocycler (MiniCycler PTC 150, MJ Research Inc, USA) programmed to pre-denature at 95°C for 2 min, denature at 95°C for 1 min, anneal at 60°C for 1 min, and extend at 72°C for 2 min, for a total of 30 cycles. The last cycle was followed by incubation at 72°C for 5 min and cooling to 4°C. The polymerase chain reaction products were 546 bp (TNF-{alpha}), 509 bp (IL-6), 256 bp (IL-10), and 970 bp (GAPDH), respectively. The products were electrophoresed on a 15 g/L agarose gel and stained with ethidium bromide. The gel was captured as a digital image and analyzed using Scion Image software (Scion Corp, Maryland, USA). Values for each sample were normalized with GAPDH as the control.

Statistics.  Data were expressed as mean ± SE. Student’s t test was used for comparisons between each treated and control group. Significance was determined by one-way ANOVA for comparisons across treated group (SPSS, version 10.0). A p value <0.05 was considered significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
NF-{kappa}B activation in intestine.  EMSA was used to assess the effect of PTX on the activation of NF-{kappa}B induced by endotoxin in intestine. Previous studies showed that the activity of NF-{kappa}B peaked 1 hr after endotoxin injection [31]. Accordingly, in this study all NF-{kappa}B measurements were made at 1 hr after endotoxin injection. NF-{kappa}B activation in the intestine was detectable at low levels in the saline controls and was markedly increased after endotoxin challenge. PTX inhibited NF-{kappa}B activation at all dosages (6.25, 12.5, 25, 50, and 100 mg/kg) in a dose-related manner. Maximal inhibition was observed at the 50 ml/kg dose. PTX injection alone did not affect the NF-kB activity (Fig. 1Go).



View larger version (49K):
[in this window]
[in a new window]
  		Fig. 1. Activation of NF-{kappa}B in the intestine. Normal saline treatment, endotoxin only (LPS), endotoxin plus PTX (6.25, 12.5, 25, 50, 100 mg/kg), and PTX only (100 mg/kg). Compared to the endotoxin-only group, all PTX treatment groups showed significantly lower activation of NF-{kappa}B (t test, *p <0.05; **p <0.01). The difference among the groups treated with PTX was statistically significant and the greatest protective effect was observed at the PTX dosage of 50 mg/kg (ANOVA, p <0.01).

 
Induction of TNF-a, IL-6, and IL-10 in intestine.  Previous studies showed that endotoxin-stimulated production of TNF-{alpha} and IL-6 peaked respectively at 1 hr [31] and 4 hr after endotoxin injection, [unpublished data]. Therefore, observations of PTX effects on TNF-{alpha} (Fig. 2AGo) and IL-6 (Fig. 2BGo) were made at these times. At all dosages, PTX suppressed the production of TNF-{alpha} and IL-6; these effects were greatest at 50 mg/kg (Fig. 2Go).



View larger version (23K):
[in this window]
[in a new window]
  		Fig. 2. Inhibitory effects of PTX on TNF-{alpha} production (A, top panel) and IL-6 (B, bottom panel) in rat intestine. The values were obtained at 1 hr (for TNF-{alpha}) or 4 hr (for IL-6) after endotoxin (LPS) treatment. Normal saline treatment, endo-toxin only, endotoxin plus PTX (6.25, 12.5, 25, 50, 100 mg/kg), and PTX only (100 mg/kg). Compared to endotoxin-only group, all PTX treatment groups showed significantly reduced production of TNF-{alpha}and IL-6 (t test, *p <0.05; **p <0.01). The difference among the groups treated with PTX was significant and the greatest protective effect was observed at the PTX dosage of 50 mg/kg for both TNF-{alpha} and IL-6 (ANOVA, p <0.01).

 
The IL-10 protein content of the small intestine is shown in Fig 3Go. Endotoxin enhanced IL-10 levels in the intestine with a peak at 4 hr after endotoxin challenge (Fig. 3AGo). We studied the effect of PTX at this time. PTX enhanced the release of IL-10 in a dose-dependent manner. The greatest effect was at 25 mg/kg (Fig. 3BGo).



View larger version (21K):
[in this window]
[in a new window]
  		Fig. 3. (Panel A) IL-10 production at 1, 4, and 6 hr after endotoxin treatment. Compared to the saline-treated group, the endotoxin-treatment group showed significantly higher expression of IL-10 (t test, *p <0.05; **p <0.01). The expression reached a peak at 4 hr after the injection of endotoxin. (Panel B): Protective effect of PTX on IL-10 production in rat intestine at 4 hr after endotoxin (LPS) injection. Normal saline treatment, endotoxin only, endotoxin plus PTX (6.25, 12.5, 25, 50, 100 mg/kg), and PTX only (100 mg/kg). Compared to the endotoxin-only group, all PTX treatment groups showed significantly higher production of IL-10 (t test, *p <0.05; **p <0.01). The difference among groups treated with PTX was statistically significant and the greatest protective effect was observed at the PTX dosage of 25 mg/kg (ANOVA, p <0.01).

 
mRNA expression of TNF-a, IL-6, and IL-10 in the intestine.  To determine if the effects of PTX on the regulation of endotoxin-induced cytokines production occur at the transcriptional level, the mRNA expression of TNF-{alpha}, IL-6, and IL-10 were measured. TNF-{alpha} mRNA expression sustained a baseline level in normal rats. Endotoxin caused a transient elevation of TNF-{alpha} mRNA in the intestine. TNF-{alpha} gene expression was analyzed 1 hr after endotoxin was injected. The PTX suppression of TNF-{alpha} mRNA expression was dose-related (Fig. 4Go).



View larger version (32K):
[in this window]
[in a new window]
  		Fig. 4. Expression of TNF-{alpha} mRNA in rat intestine. Normal saline treatment, endotoxin only, endotoxin plus PTX (6.25, 12.5, 25, 50, 100 mg/kg), PTX only (100 mg/kg). Compared to the endotoxin-only group, all PTX treatment groups showed significantly lower activation of TNF-{alpha}mRNA (t test, *p <0.05; **p <0.01). The lowest expression of TNF-{alpha} was observed in the group treated with 50 mg/kg of PTX. The difference among the PTX-treated groups was statistically significant (ANOVA, p <0.01).

 
IL-6 mRNA expression in the small intestine is shown in Fig. 5Go. Endotoxin treatment enhanced IL-6 mRNA expression in the intestine. We measured the protective effect of PTX at 4 hr after endotoxin injection. PTX suppressed IL-6 mRNA expression at all tested dosages. Expression of IL-6 was lowest after administration of 50 mg/kg of PTX (Fig. 5Go).



View larger version (30K):
[in this window]
[in a new window]
  		Fig. 5. Expression of IL-6 in the intestine. Normal saline treatment, endotoxin (LPS) only, endo-toxin plus PTX (6.25, 12.5, 25, 50, 100 mg/kg), PTX only (100 mg/kg). Compared to endotoxin-only groups, all PTX treatment groups showed significantly lower activation of IL-6 mRNA (t test, *p <0.05; **p <0.01). The lowest expression of IL-6 mRNA was observed in the group treated with 50 mg/kg of PTX. The difference among the PTX-treated groups was statistically significant (ANOVA, p <0.01).

 
Endotoxin enhanced IL-10 expression in the intestine, reaching a peak at 4 hr after endotoxin challenge. As shown in Fig 6Go, PTX enhanced IL-10 mRNA expression in a dose-dependent manner.



View larger version (32K):
[in this window]
[in a new window]
  		Fig. 6. Expression of IL-10 mRNA in the intestine. Normal saline treatment, endotoxin only (LPS), endotoxin plus PTX (6.25, 12.5, 25, 50, 100 mg/kg), PTX only (100 mg/kg). Compared to endotoxin-only groups, all PTX treatment groups showed higher expression of IL-10 mRNA (t test, *p <0.05; **p <0.01). The highest expression of IL-10 mRNA was observed in the group treated with 25 mg/kg of PTX. The difference among the PTX-treated groups was statistically significant (ANOVA, p <0.01).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Excessive production of proinflammatory cytokines is believed to contribute significantly to the lethality of sepsis caused by Gram-negative bacteria [32]. Although many studies have investigated how PTX regulates the production of proinflammatory cytokines induced by endotoxin, most previous studies were performed in vitro [10–13]. In the present study, we evaluated in vivo the protective effect of PTX pretreatment and how the effect depends on PTX dosage. Compared to in vitro studies, our protocol was more physiological and closer to the clinical situation. Our results shed new light on how PTX affects endotoxin-induced production of proinflammatory cytokines.

Several conclusions can be gleaned from our findings. First, among the cytokines produced in the intestinal mucosa during inflammation, TNF-{alpha} and IL-6 are particularly important because of their multiple biological effects both locally and systemically. TNF-{alpha} is a proinflammatory cytokine that acts as a mediator of host defenses against infection and is principally expressed in macrophages [33–34], where its secretion may increase 10,000-fold after exposure to endotoxin [34]. Along with numerous beneficial roles in immune regulation, TNF-{alpha} has been implicated in the pathogenesis of acute and chronic inflammatory disease [35]. It is regarded as the most important proinflammatory cytokine and is released promptly after an inflammatory stimulus [36].

IL-6 is a multifunctional cytokine that is involved in many facets of the systemic inflammatory response. IL-6 has an important role in the regulation of mucosal protein synthesis during sepsis and endotoxemia [37]. In addition, IL-6 is a significant regulator of acute-phase protein synthesis, mainly in the liver [38], but in intestinal epithelial cells as well [14]. IL-6 may be a mediator of increased mucosal permeability during sepsis and other critical illness [23]. The correlation between IL-6 levels and severity of disease underscore the importance of this cytokine in septic shock [39].

Our data showed (a) that PTX suppressed both endotoxin-induced TNF-{alpha} and IL-6 production in the intestine and (b) that this suppression was achieved by down-regulating the mRNA expression. At all the PTX dosages tested, the production of TNF-{alpha} and IL-6 and the corresponding mRNA expressions were significantly lower than those in the saline treated group.

Second, the finding that PTX can down-regulate the endotoxin-induced activation of NF-{kappa}B is important, considering the putative role of NF-{kappa}B in the pathogenesis of septic shock. NF-{kappa}B comprises a family of Rel-related transcription factors that mediate inflammatory processes. In the cytosol, NF-{kappa}B proteins form heteromeric complexes with an inhibitory subunit called I{kappa}B. NF-{kappa}B is activated after the phosphorylation of I{kappa}B, which can be induced by endotoxin. The phosphorylated I{kappa}B is degraded, liberating NF-{kappa}B dimers that are translocated to the cell nucleus and initiate transcription of target genes [40].

Many effector genes, including those encoding TNF-{alpha} and IL-6, are in turn regulated by NF-{kappa}B [41] because the regulatory regions of those genes are responsive to NF-{kappa}B [42]. Blocking NF-{kappa}B activation may be an effective means to diminish NF-{kappa}B transcription of a variety of genes, including the other cytokines involved in the production of inflammation. Our data showed that PTX down-regulated the activation of NF-{kappa}B in a dose-dependent manner. We did not find any change of NF-{kappa}B activation in the control group administered PTX (100 mg/kg) only, without endotoxin, which excludes a direct effect of PTX per se on NF-{kappa}B activity.

Third, the production and expression of IL-10 was enhanced by PTX. Endotoxin induces significant alterations in inflammatory mediators, including cytokines that may ultimately affect intestinal barrier function [43,44]. IL-10 plays a critical role in intestinal immunity and integrity because it is a potent suppressor of inflammatory cytokine synthesis [45,46]. IL-10 is known to inhibit the secretion of proinflammatory cytokines such as IL-1, IL-6, IL-8, interferon gamma, and TNF-{alpha}, and at the same time up-regulates the anti-inflammatory agent IL-1ra [47]. IL-10 also suppresses the generation of superoxide, a tissue-destructive free radical that is produced by polymorphonuclear cells.

Our experiment revealed an increased level of IL-10 at 4 hr after PTX treatment, accompanied by decreased levels of TNF-{alpha} and IL-6. One may speculate that PTX might inhibit the release of proinflammatory mediators by enhancement of IL-10 production. However, in our experiment, IL-10 did not peak until 4 hr, which is subsequent to the peak of TNF-{alpha} and IL-6 production. Therefore, the down regulation of TNF-{alpha} and IL-6 by PTX cannot act through enhanced production of IL-10.

Based on in vitro studies, the effect of PTX on IL-10 production depends heavily on the PTX concentration and the cell types used. Some experiments indicated that PTX enhanced the production of IL-10 in macrophage cells at lower concentrations and inhibited IL-10 production at higher concentrations. The data from our in vivo experiment did not show any suppressive effect of PTX on the production of IL-10. However, the enhancing effect of PTX became weaker at PTX concentrations greater than 25 mg/kg.

Fourth, in our study, the greatest effects of PTX were generally observed at a dose of 50 ml/kg; at the100 mg/kg dose, the protective effects of PTX declined, which suggests a biphasic dose response. This might be explained by low and high concentrations of the drug having different effects on receptor affinity for other chemoattractants, on membrane fluidity, or on mediators. The question why a higher dosage of PTX (100 mg/kg) caused less inhibition of NF-{kappa}B remains unanswered. Seeking the answer to this question is important because NF-{kappa}B mediates the expression of multiple inflammatory cytokines genes [48]. Experiments are being planned to test PTX dosages >100 mg/kg and to explore the mechanisms whereby PTX inhibits NF-{kappa}B activation.

In summary, we demonstrated (a) that PTX suppresses endotoxin-induced TNF-{alpha}, IL-6 production, and their mRNA expressions in rat intestine, and (b) that PTX enhances endotoxin-induced IL-10 production and its mRNA expression in rat intestine. The suppressive effect on TNF-{alpha}and IL-6 may be mediated by inhibition of NF-{kappa}B activation. The enhanced production of IL-10 suggests a NF-{kappa}B-independent mechanism of IL-10 gene activation. Further studies are needed to elucidate the mechanisms of these PTX effects.


   Acknowledgment
 
The authors thank Dr. Genbao Feng for technical assistance.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sriskandan S, Cohen J. Gram-positive sepsis: Mechanisms and differences from gram-negative sepsis. Infect Dis Clin North Am 1999;13:397–412.[Medline]
  2. Feezor RJ, Oberholzer C, Baker HV, Novick D, Rubin-stein M, Moldawer LL, Pribble J, Souza S, Dinarello CA, Ertel W, Oberholzer A. Molecular characterization of the acute inflammatory response to infections with gram-negative versus gram-positive bacteria. Infect Immun 2003;71:5803–5813.[Abstract/Free Full Text]
  3. Hotchkiss RS, Karl IE. The pathophysiology and treatment of sepsis. N Engl J Med 2003;348:138–150.[Free Full Text]
  4. Calandra T. Pathogenesis of septic shock: implications for prevention and treatment. J Chemother 2001;13(Spec No 1):173–180.
  5. Hoffman WD, Natanson C. Endotoxin in septic shock. Anesth Analg 1993;77:613–624.[Free Full Text]
  6. Tan XD, Wang H, Gonzalez-Crussi FX, Chang H, Gonzalez-Crussi F, Hsueh W. Platelet activating factor and endotoxin increase the enzyme activity and gene expression of type II phospholipase A2 in the rat intestine. Role of polymorphonuclear leukocytes. J Immunol 1996; 156:2985–2990.[Abstract]
  7. Wang Q, Wang JJ, Boyce S, Fischer JE, Hasselgren PO. Endotoxemia and IL-1 beta stimulate mucosal IL-6 production in different parts of the gastrointestinal tract. J Surg Res 1998;76:27–31.[Medline]
  8. Parikh AA, Salzman AL, Fischer JE, Szabo C, Hasselgren PO. Interleukin-1 beta and interferon-gamma regulate interleukin-6 production in cultured human intestinal epithelial cells. Shock 1997;8:249–255.[Medline]
  9. Porter JM, Cutler BS, Lee BY, Reich T, Reichle FA, Scogin JT, Strandness E. Pentoxifylline efficacy in the treatment of intermittent claudication: Multicenter controlled double-blind trial with objective assessment of chronic occlusive arterial disease patients. Am Heart J 1982; 104:66–72.[Medline]
  10. Strieter RM, Remick DG, Ward PA, Spengle RN, Lynch JP, Larrick J, Kunkel SL. Cellular and molecular regulation of TNF-alpha production by pentoxifylline. Biochem Biophys Res Commun 1988;155:1230–1236.[Medline]
  11. Zabel P, Schonharting MM, Wolter DT Schade UF. Oxpentifylline in endotoxaemia. Lancet 1989;2:1474–1477.[Medline]
  12. Schandene L, Vandenbussche P, Crusiaux A, Alegre ML, Abramowicz D, Dupont E, Content J, Goldman M. Differential effects of pentoxifylline on the production of tumour necrosis factor-alpha (TNF-{alpha}) and interleukin-6 (IL-6) by monocytes and T cells. Immunology 1992;76:30–34.[Medline]
  13. Bienvenu J, Coulon L, Barbier Y, Doche C, Lepape A, Guenounou M. Study of pentoxifylline of TNF-{alpha} and interleukin-6 secretion in healthy and septic patients by the use of an ex-vivo model on whole blood. Nouv Rev Fr Hematol 1992;34:65–67.
  14. D’Hellencourt CL, Diaw L, Cornillet P, Guenounou M. Differential regulations of TNF alpha, IL-l beta, IL-6, IL-8, TNF beta, and IL-10 by pentoxifylline. Int J lmmunopharm 1996;18:739–748.
  15. Cavaillon JM, Munoz C, Fitting C, Misset B, Carlet J. Circulating cytokines: the tip of the iceberg? Circ Shock 1992;38:145–152.[Medline]
  16. Keogh C, Fong Y, Marano MA, Seniuk S, He W, Barber A, Minei JP, Felsen D, Lowry SF, Moldawer LL. Identification of a novel tumor necrosis factor alpha/cachectin from the livers of burned and infected rats. Arch Surg 1990;125:79–84.[Abstract/Free Full Text]
  17. Wang Q, Meyer TA, Boyce ST, Wang JJ, Sun X, Tiao G, Fischer JE, Hasselgren PO. Endotoxemia in mice stimulates production of complement C3 and serum amyloid A in mucosa of small intestine. Am J Physiol 1998;275:R1584–1592.
  18. Wang Q, Wang JJ, Fischer JE, Hasselgren PO. Mucosal production of complement C3 and serum amyloid A is differentially regulated in different parts of the gastrointestinal tract during endotoxemia in mice. J Gastrointest Surg 1998;2:537–546.[Medline]
  19. Meyer TA, Wang J, Tiao GM, Ogle CK, Fischer JE, Hasselgren PO. Sepsis and endotoxemia stimulate interleukin-6 production. Surgery 1995;118:336–342.[Medline]
  20. Magnotti, LJ, Upperman, JS, Xu D-Z, Lu Q; Deitch, EA. Gut-derived mesenteric lymph but not portal blood increases endothelial cell permeability and promotes lung injury after hemorrhagic shock. Ann Surg 1998;228:518–527.[Medline]
  21. Sambol JT, Xu DZ, Adams CA, Magnotti LJ, Deitch EA. Mesenteric lymph duct ligation provides long term protection against hemorrhagic shock-induced lung injury. Shock 2000;14:416–419.[Medline]
  22. Deitch EA. Role of the gut lymphatic system in multiple organ failure. Curr Opin Crit Care 2001;7:92–98.[Medline]
  23. Langkamp HB, Donovan TB, Pate LM, Maull CD, Kudsk KA. Increased intestinal permeability following shock and penetrating trauma. Crit Care Med 1995;23: 660–664.[Medline]
  24. Hasselgren PO. The significance of intestinal cytokines. In Cytokines and the Abdominal Surgeon (Schein M, Wise L, Eds), Landes, Austin, TX, 1998; pp 197–213.
  25. Gullo A, Berlot G. Ingredients of organ dysfunction or failure. World J Surg 1996;20:430–436.[Medline]
  26. Nieuwenhuijzen GA, Goris RJ. The gut: the ‘motor’ of multiple organ dysfunction syndrome? Curr Opin Clin Nutr Metab Care 1999;2:399–404.[Medline]
  27. Baldwin AS Jr. The NF-{kappa}B and I{kappa}B proteins: new discoveries and insights. Ann Rev Immunol 1996;14:649–683.[Medline]
  28. Jilg S, Barsig J, Leist M, Kusters S, Volk HD, Wendel A. Enhanced release of interleukin-10 and soluble tumor necrosis factor receptors as novel principles of methyl-xanthine action in murine models of endotoxic shock. J Pharmacol Exp Ther 1996;278:421–431.[Abstract/Free Full Text]
  29. Benbernou N, Esnault S, Shin HC, Fekkar H, Guenounou M. Differential regulation of IFN-gamma, IL-10 and inducible nitric oxide synthase in human T cells by cyclic AMP-dependent signal transduction pathway. Immunology 1997;91:361–368.[Medline]
  30. Shimada T, Watanaba N, Ohtsuka Y, Endoh M, Kojima K, Hiraishi H, Terano A. Polaprezine downregulates proinflammatory cytokine-induced nuclear factor-{kappa}B activation and interleukin-8 expression in gastric epithelial cells. J Pharmacol Exp Ther 1999;291:345–352.[Abstract/Free Full Text]
  31. Sun J, Li F, Chen J, Xu J. Effect of ketamine on NF-kappa B activity and TNF-alpha production in endotoxin-treated rats. Ann Clin Lab Sci 2004;34:181–186.[Abstract/Free Full Text]
  32. Beishuizen A, Vermes I, Haanen C. Endogenous mediators in sepsis and septic shock. Adv Clin Chem 1998:33: 55–131[Medline]
  33. Beutler B, Cerami A. Tumor necrosis, cachexia, shock, and inflammation: a common mediator. Annu Rev Biochem 1988;57:505–518.[Medline]
  34. Old LJ. Tumor necrosis factor: another chapter in the long history of endotoxin. Nature 1987;330:602–603.[Medline]
  35. Beutler B, Cerami A. Cachectin and tumour necrosis factor as two sides of the same biological coin. Nature 1986;320:584–588.[Medline]
  36. Hesse DG, Tracey KJ, Fong Y, Manogue KR, Palladino MA Jr, Cerami A, Shires GT, Lowry SF. Cytokine appearance in human endotoxemia and primate bacteremia. Surg Gynecol Obstet 1988;166:147–153.[Medline]
  37. Wang Q, Fischer JE, Hasselgren PO. Treatment of endotoxemic mice with anti-interleukin-6 antibody paradoxically increases interleukin-6 levels and stimulates musosal protein synthesis. Arch Surg 1997;132:82–88.[Abstract/Free Full Text]
  38. Gauldie J, Richards C, Baumann H. IL-6 and the acute phase reaction. Res Immunol 1992;143:755–759.[Medline]
  39. Ohzato H, Yoshizaki K, Nishimoto N, Ogata A, Tagoh H, Monden M, Gotoh M, Kishimoto T, Mori T. Interleukin-6 as a new indicator of inflammatory status: detection of serum levels of interleukin-6 and C-reactive protein after surgery. Surgery 1992;111:201–209.[Medline]
  40. Beg AA, Finco PV, Nantermet TS, Baldwin AS Jr. Tumor necrosis factor and interleukin-1 lead to phosphorylation and loss of I kappa B alpha: a mechanism for NF-kappa B activation. Mol Cell Biol 1993;13:3301–3310.[Abstract/Free Full Text]
  41. Baeuerle PA, Baltimore D. NF-kappa B: ten years after. Cell 1996;87:13–20.[Medline]
  42. Blackwell TS, Christman JW. The role of nuclear factor kappa B in cytokine gene regulation. Am J Respir Cell Mol Biol 1997;17:3–9.[Abstract/Free Full Text]
  43. Deitch EA, Morrison J, Berg R, Specian RD. Effect of hemorrhagic shock on bacterial translocation, intestinal morphology, and intestinal permeability in conventional and antibiotic-decontaminated rats. Crit Care Med 1990;18:529–536.[Medline]
  44. Deitch EA, Xu D, Franko L, Ayala A, Chaudry IH. Evidence favoring the role of the gut as a cytokine-generating organ in rats subjected to hemorrhagic shock. Shock 1994;1:141–146.[Medline]
  45. DeWaal MR, Abrams J, Bennett B, Figdor CG, deVries JE. Interleukin-10 (IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J Exp Med 1991;174:1209–1220.[Abstract/Free Full Text]
  46. Fiorentino DF, Bond MW, Mosmann TR. Two types of mouse T-helper cell IV Th2 clones secrete a factor that inhibits cytokine production by Th1 clones. J Exp Med 1989;170:2081–2095.[Abstract/Free Full Text]
  47. Howard M, O’Garra A. Biological properties of inter-leukin-10. Immunol Today 1992;13:198–200.[Medline]
  48. Liu SF, Ye X, Malik AB. Inhibition of NF-kappaB activation by pyrrolidine dithiocarbamate prevents In vivo expression of proinflammatory genes. Circulation 1999; 100:1330–1307.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Toxicol SciHome page
F. F. Tukov, J. P. Luyendyk, P. E. Ganey, and R. A. Roth
The Role of Tumor Necrosis Factor Alpha in Lipopolysaccharide/Ranitidine-Induced Inflammatory Liver Injury
Toxicol. Sci., November 1, 2007; 100(1): 267 - 280.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ji, Q.
Right arrow Articles by Xu, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ji, Q.
Right arrow Articles by Xu, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS