ACLS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, Q.
Right arrow Articles by Ding, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, Q.
Right arrow Articles by Ding, Y.
Annals of Clinical & Laboratory Science 34:87-93 (2004)
© 2004 Association of Clinical Scientists

The Optimal Hepatocyte Density for a Hollow-Fiber Bioartificial Liver

Qingxiang Xu, Xitai Sun, Yudong Qiu, Heyuan Zhang and Yitao Ding
Hepatobiliary Surgery Department, Affiliated Drum Tower Hospital of Medical College, Nanjing University, Nanjing, Peoples Republic of China

Address correspondence to Qingxiang Xu, M.D., Hepatobiliary Surgical Department, Affiliated Drum Tower Hospital of Nanjing University Medical College, Zhongshan Road 321, Nanjing, PR China 210008; tel 86 25 3304616 11601; fax: 86 25 3317016; e-mail: xqx008{at}hotmail.com.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
A bioartificial liver (BAL) based on viable porcine hepatocytes can serve as a bridge to liver transplantation in patients with acute liver failure (ALF). To support liver functions, an adequate mass of hepatocytes is needed, which depends upon the cell density in the BAL device. This study evaluated the optimal density of hepatocytes within BAL devices that were constructed by perfusing porcine hepatocyte suspensions mixed with cytodex-3 into polysulfon hollow-fibers. The BAL devices were prepared with 6 different cell densities. The mass of hepatocytes in each device was evaluated for (a) cell viability, (b) ability to degrade diazepam, (c) ability to synthesize urea, (d) incorporation of [3H]-leucine into protein, (e) glucose-6-phosphatase activity, (f) total RNA content, and (g) p53 gene expression. Hepatocyte viability was about 90% in each device. With increasing hepatocyte density, the diazepam concentration in the medium decreased from 9.26±0.96 mg/L at 1 x 105 cells/ml to a minimum of 5.25±1.02 mg/L at 5 x106 cells/ml and thereafter remained at low levels. Urea production and [3H]-leucine incorporation into protein increased progressively until the cell density reached 5 x 106/ml and thereafter remained at high levels. Glucose-6-phosphatase activity and total RNA content stayed at high levels until the cell density reached 5 x 106/ml and then progressively decreased. p53 gene expression differed from the other parameters, since it increased only when the cell density reached 5 x 107/ml. In conclusion, the density of 5 x 106 cells/ml is a critical inflection point for most of the functional parameters, although p53 gene expression is not elevated at this cell density. These findings suggest that 5 x 106 cells/ml is the optimal hepatocyte density in the hollow-fiber BAL device.

(received 28 March 2003; accepted 8 August 2003)

Keywords: bioartificial liver, acute liver failure, hepatocytes


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Orthotopic liver transplantation (OLT) is one of the most effective methods for therapy of patients with acute liver failure (ALF) [1,2], whose mortality decreases to <30% when a donor liver has been transplanted [3,4]. However OLT is not the ideal solution to ALF; it is expensive and it denies the patient an opportunity to recover native liver function. The worldwide shortage of donor organs gives little hope for an ALF patient to receive a matched organ in time [2], and it increases the need for strategies that facilitate the appropriate utilization of OLT. These considerations highlight the concept of temporary restoration of liver functions as a bridge to liver transplantation.

Development of a bioartificial liver (BAL) based on viable hepatocytes is one of the ways to solve this problem [5–7]. The state-of-the-art embodiment of this device is a mass of well nourished, viable hepatocytes immobilized on a mechanical support and separated from the patient’s body by a semi-permeable membrane. Several kinds of BAL are currently being investigated. They can be classified according to the immobilization technique used: glass plate [8], microcarrier [9,10], hollow-fiber membrane [11–13], encapsulation [14], and 3-dimensional carrier [15,16]. Of these, the hollow-fiber membrane is the one most commonly used.

It is generally considered that large numbers of hepatocytes are needed in the hollow-fiber BAL to provide sufficient support for liver functions in an ALF patient [17,18]. Therefore high density cultivation of hepatocytes is advocated. Obviously, the functions of a hollow-fiber BAL device cannot be elevated continuously by increasing the cell density. There must be a cell density above which the BAL device does function efficiently. The goal of this study was to establish the optimal hepatocyte density for a hollow-fiber BAL device.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Acknowledgements
 References
 
Animals.  Healthy Chinese experimental miniature swine were purchased from the Experimental Center of Beijing Forestry University. The swine were treated in accordance with the Animal Welfare Guidelines established by the Affiliated Drum Tower Hospital of Nanjing University Medical College. After receipt, the swine were housed for at least one week in a temperature- and humidity-controlled room (20–25°C, humidity 50–70%) with a 12/12 hr light/dark cycle. The swine were fed a cereal based diet and given ad libitum access to water. During 12 hr before the surgical operation, access to water only was allowed.

Hepatocytes preparation.  Hepatocytes were isolated from swine by in situ liver perfusion and enzymatic collagenase digestion as described by Berry and Friend [19] and modified by Seglen [20]. Briefly, under katamine anesthesia (50 mg/kg), a midline incision and cannulation of the portal vein were performed. The inferior vena cava was ligated above the renal vein and then cannulated close to the heart. The liver was perfused with 3 L of Hanks solution (4°C, pH 7.6) through the portal vein. The liver was then circularly perfused with 500 ml of 0.5% collagenase iv solution (Gibco BRL, Merelbeke, Belgium) at a constant flow of 20 ml/min. The softened liver was excised and hepatocytes were separated from the hepatic connective tissue by gentle agitation. The cell suspension was filtered though a sterile metal mesh (50 µm). After being rinsed 3 times in Hanks solution, the cells were suspended in non-serum RPMI 1640 culture medium (Sigma, St Louis, MO) with 0.25 mM glucose, 200 µg/L hydrocortisone, 1 mg/L hepatocyte growth factor, 10 µg/L epidermal growth factor, 20 µg/L nerve growth factor, 100 µg/L insulin, 4 µg/L glucagon, 6.25 mg/L transferrin, 10 mg/L linoleic acid, 2 mM glutamine, 0.5 g/L bovine serum albumin, 3 nM sodium selenate, 0.1 µg/L CuSO4·5H2O, 50 pM ZnSO4·7H2O, 15 mmol HEPES buffer, 200 µg/L cefaperazone, 1 x 105 U/L penicillin, and 100 mg/L streptomycin. Cell viability was determined by the trypan blue exclusion test. Only suspensions with cell viability of >=95% were used. After addition of cytodex-3 (Pharmagen, St Louis, MO), the cell suspension was incubated in non-serum RPMI 1640 culture medium overnight at 37°C in 95% air/5% CO2.

Construction of the bioartificial liver.  Polysulfon hollow-fiber (1.0 mm internal diameter and 0.1 mm wall thickness) was purchased from TECA Corp. (Hong Kong, China). The molecular cutoff was 100 kD. Before use, the fiber was sterilized, washed with sterile saline, and rinsed in non-serum RPMI 1640 culture medium for at least 12 hr. The hepatocyte culture mixture was introduced into the fiber and the fiber ends were clamped with forceps [21]. The hepatocytes in the BAL device were then cultured in vitro as described below.

Experimental design.  This study comprised 6 trials of BAL devices with graded levels of cell density. They were group A: cell density 1 x105/ml; group B: cell density 5 x 105/ml; group C: cell density 1 x 106/ml; group D: cell density 5 x 106/ml; group E: cell density 1 x 107/m; and group F: cell density 5 107/ml. After culture for 3 days in non-serum RPMI 1640 medium, the trypan blue exclusion test was used to determine cell viability and several indices of cell function were measured.

Diazepam degradation.  Briefly, 20 mg/L of diazepam was added to the culture system. After culture for 24 hr, the diazepam concentration in the medium supernatant was determined by fluorescence polarization immunoassay (TDx Analyzer, Abbott Labsoratories, Abbott Park, IL). The diminution of diazepan concentration was used as an index of degradative function of the hepatocytes.

Synthetic and metabolic functions of the hepatocytes were evaluated by measurements of urea production, [3H]-leucine incorporation into protein, and glucose-6-phosphatase (G-6-Pase) activity. In brief, 10 mM (final concentration) of NH4Cl was added to the culture system. After 24 hr, urea concentration in the supernatant was measured by a urea assay kit [22] (Randox Laboratories, Ltd., Antrim, UK). Protein synthesis of the hepatocytes was analyzed using [3H]-leucine incorporation as described by Tong [23]. After addition of 1 µCi/ml [3H]-leucine to the medium and culturing in 5% (v/v) CO2 at 37°C for 24 hr, the hepatocytes were washed 3 times with Hanks solution. Samples were precipitated with 10% (v/v) trichloroacetic acid (TCA) and 100% ethanol (v/v) on cellulose filter paper and the radioactivity was counted in a liquid scintillation system (Beckman Instruments, Fullerton, CA). The radioactivity served as an index of incorporation of [3H]-leucine into newly synthesized proteins. G-6-Pase activity was measured according to Chen [8]. Hepatocytes were harvested and homogenized in distilled water. G-6-Pase activity was determined by quantitation of the phosphoric acid formed by hydrolysis of glucose-6 phosphate; the activity was expressed as nmol phosphoric acid/1010 cells [24].

Total RNA content.  Samples of 5 x 106 hepatocytes were collected and the total RNA was extracted at 4°C by use of the TRIzol kit (Gibco BRL, Merelbeke, Belgium). The quality of extracted RNA was checked by denatured formaldehyde gel electrophoresis and Northern blotting with 32P-labeled ß-actin cDNA as a probe. Absorbance at 260 and 280 nm of each RNA sample was measured by spectrophotometry and RNA content was calculated by the equation: RNA (µg/ml) = OD260 nm x 40 µg/ml.

p53 gene expression was detected by the reverse transcription PCR (RT-PCR) method. Purified RNA was additionally extracted with phenol-chloroform-isoamyl alcohol (25:24:1) and chloroform and then precipitated by addition of sodium acetate (3 M) and 100% ethanol. Purified RNA (5 µg) was preincubated with random hexamer and water (10 min, 70°C). Four hundred units of reverse transcriptase (Gibco BRL, Merelbeke, Belgium) were added, together with DTT and deoxynucleoside triphosphates (dNTP; Pharmacia LKB, Uppsala, Sweden), and the reaction was continued for 60 min at 37°C. The reverse transcription products were amplified in a two-step PCR using Taq DNA polymerase and special p53 primers (Shanghai Biotechnique Corp., PR China). The p53 primers were as follows: sense: CCTCACCATCATCACACTGG; antisense: AGCTCTCGGAACATCTCGAA. Gap DH cDNA (Shanghai Biotechnique Corp.) was co-amplified to standardize the sample products. PCR was performed for 30 cycles (94°C for 30 sec; 60°C for 30 sec; 72°C for 1 min). The products were separated by electrophoresis in agarose gel (1.5%) mixed with 0.5 µg/mL ethidium bromide. The signal strength of p53 gene expression was semiquantitatively analyzed by densitometry.

Statistics.  Results were expressed as means ± SD. One way ANOVA and the Tukey test were performed with SPSS software (SPSS Inc. Chicago, IL). A probability <0.05 was considered to be significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Acknowledgements
 References
 
Cell viability.  Three swine were killed in this study. The average yield of hepatocytes was 1.82 x 1010, with cell viability ranging from 95 to 98%. After culture in the polysulfon hollow-fiber for 3 days, cell viability of each cell density group was about 90% (Fig. 1Go). No significant differences were found among the groups.



View larger version (18K):
[in this window]
[in a new window]
  		Fig. 1. Cell viability (%) of porcine hepatocytes following culture for 3 days in hollow-fiber BAL devices at 6 graded levels of cell density. Group A: 1 x 105/ml; group B: 5 x 105/ ml; group C: 1 x 106/ml; group D: 5 x 106/ml; group E: 1 x 107/ml; group F: 5 x 107/ml. No significant differences were noted among the groups.

 
Diazepam degradation.  Diazepam concentrations in the culture medium are shown in Fig. 2Go. With increasing cell density, diazepam concentration decreased progressively from 9.26 ± 0.96 mg/L in group A (cell density 1 x 105/ml) to 5.25 ± 1.02 mg/L in group D (cell density 5 x106/ml), and remained at low levels in groups E and F.



View larger version (13K):
[in this window]
[in a new window]
  		Fig. 2. Residual concentrations of diazepam (mg/L) were measured in culture media at 24 hr after addition of diazepam (20 mg/L) to BAL systems that contained porcine hepatocytes at 6 graded levels of cell density. Group A: 1 x 105/ml; group B: 5 x 105/ml; group C: 1 x 106/ml; group D: 5 x 106/ml; group E: 1 x 107/ml; group F: 5 x 107/ml. Significant differences (p < 0.01) were found for groups A or B versus groups D, E, or F.

 
Synthetic and metabolic functions.  As shown in Table 1Go, urea production and [3H]-leucine incorporation into protein showed similar trends; these indices increased progressively as cell density rose from 1 x 105/ml to 5 x 106/ml and remained relatively constant at higher levels of cell density. Significant differences were found between groups A or B and groups D, E, or F (p < 0.01). G-6-Pase activity showed a different trend. In groups A to D, with cell density <5 x 106/ml, G-6-Pase activity was maintained at a stable high level. When cell density exceeded 5 x 106/ml, G-6-Pase activity decreased progressively to 13.5 ± 2.0 ng/L in group F (cell density 5 x 107/ml) with rising cell density. Significant differences were found between group F and groups A, B, or C (p < 0.01).


View this table:
[in this window]
[in a new window]
  		Table 1. Indices of urea production, [3H]-leucine incorporation into protein, and G-6-Pase activity in the supernatant media of porcine hepatocytes following culture for 24 hr in hollow-fiber BAL devices at 6 graded levels of cell density. Group A: 1 x 105/ml; group B: 5 x 105/ml; group C: 1 x 106/ml; group D: 5 x 106/ml; group E: 1 x 107/ml; group F: 5 x 107/ml.
 
Total RNA abundance showed the same trend as G-6-Pase activity (Fig.3Go). When cell density was <= 5 x 106/ml (groups A,B,C, or D), total RNA was maintained at approximately the same high levels. In group E (cell density 1 x 107/ml), the total RNA content began to decrease and in group F (cell density 5 x 107/ml), it was diminished to 9.19 ± 1.09 µg/106 cells.

p53 gene expression was constant in the first 5 groups and significantly upregulated in group F (Fig. 4Go).



View larger version (104K):
[in this window]
[in a new window]
  		Fig. 4. Agarose gel electrophoretic pattern of p53 RNA obtained by RT-PCR and visualized with ethidium bromide to show p53 gene expression in porcine hepatocytes following culture for 3 days in hollow-fiber BAL devices at 6 graded levels of cell density. The lanes (from left to right) display p53 expression of Group A: 1 x 105/ml; group B: 5 x 105/ml; group C: 1 x 106/ml; group D: 5 x 106/ml; group E: 1 x 107/ml; group F: 5 x 107/ml; (RNA standards in the right lane). The p53 expression was significantly upregulated in group F.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Acknowledgements
 References
 
Extracorporeal bioartificial liver (BAL), which provides detoxification and metabolic functions, has been used to bridge ALF patients who await liver transplantation, as well as to provide temporary liver support to enhance spontaneous recovery of the native liver [5–16]. Hepatocytes are supported within a matrix in a bioreactor that allows for biochemical interactions with the patient’s blood. Due to scarcity of allogenic donor livers, xenogenic hepatocytes [25] (always procured from swine) or immortalized human hepatocytes [26,27] (obtained from hepatomas) are utilized in such devices. Immuno-isolation of the patient is achieved either by isolating hepatocytes from the blood or plasma by a semi-permeable membrane, or by various procedures of plasma separation and bioreactor out-flow filtration.

Approximately 20–40% of a patient’s normal hepatocytes mass is required to support liver functions, although only 2% of the normal mass may be sufficient to reduce cytokines that are known to inhibit hepatic regeneration in ALF [7,28]. The number of hepatocytes loaded in BAL devices that are currently used in clinical trials varies markedly from 1 x 109 to 1 x1011. In some medical centers, supplemental oxygen supply is used in BAL devices for high-density-culture. Gerlach et al [15,16] designed a 3-dimensionally woven capillary BAL system with independent oxygen supply. This BAL system could load 2.5 x 109 hepatocytes and it maintained external metabolism for up to 5 weeks. Jasmund et al [29] used an oxygenating hollow-fiber bioreactor with a high density of 2.5 x 107 cells/ml that provided sufficient function for clinical use.

Most groups have used BAL systems without additional oxygen supply. Morsiani et al [30] developed a radial flow bioreactor and seeded it with 230 g of freshly isolated porcine hepatocytes. This device was used in 7 ALF patients who were in grade III-IV coma, and the patients all survived. In a study by Rozga et al [31], a porous hollow-fiber bioreactor was constructed with 5 x 109 matrix-attached hepatocytes; clinical improvement was noted when the device was used to treat ALF patients.

The number of hepatocytes that can be cultured in the fixed volume of a BAL device is obviously limited by the cell density. It is not simply that the higher the density of hepatocytes, the better the function of a BAL device. Pahernik et al [32] evaluated different cell densities in non-woven polyurethane matrices. The total DNA of cells, lactate dehydrogenase release, and cytochrome P450 activity were used as functional parameters in their study, which indicated that 1 x 106 cells/ml was the optimal cell density.

In most hollow-fiber BAL devices, hepatocytes are cultured in an extra-capillary chamber. When blood or plasma flows through the inside of fibers, exchanging activity may take place freely through the membrane. There are also devices in which hepatocytes are cultured in a hollow-fiber [21,33]. In our study, we chose the latter design because it functions as well as the other kinds and can be studied economically.

In our study, the cell viabilities of the 6 groups with different cell densities were all about 90% after being cultured for 3 days. Diazepam degradation, urea production, [3H]-leucine incorporation, G-6-Pase activity, total RNA abundance, and p53 gene expression were chosen as parameters of BAL function [34]. From the first 3 of these parameters (diazepan degradation, urea production, and [3H]-leucine incorporation), we found that hepatocyte metabolic and synthetic functions improved with increasing cell density up to 5 x 106 cells/ml, and then remained at stable levels.

G-6-Pase activity and total RNA abundance were additional parameters of the metabolic and synthetic functions of BAL. Because these parameters were both adjusted to same number of cells (1 x 1010 cells) in our study, they may better reflect the functions of individual hepatocytes. We found that these 2 parameters remained at high levels when cell density was lower than 5 x 106 cells/ml and then decreased as the cell density increased.

The p53 gene is a suppressive gene that may be upregulated in inactive tissues [35]. In our study, p53 gene expression was upregulated at a cell density of 5 x 107 cells/ml. In our study, the cell density of 5 x 106 cells/ml is an inflection point for diazepam degradation, urea production, [3H]-leucine incorporation, G-6-Pase activity, and total RNA content, while p53 gene expression is not upgraded at this cell density. We conclude that 5 x 106 cells/ml is the optimal hepatocyte density in our hollow-fiber BAL.



View larger version (14K):
[in this window]
[in a new window]
  		Fig. 3. Total RNA content (µg/1010 cells) of porcine hepatocytes following culture for 3 days in hollow-fiber BAL devices at 6 graded levels of cell density. Group A: 1 x 105/ml; group B: 5 x 105/ml; group C: 1 x 106/ml; group D: 5 x 106/ml; group E: 1 x 107/ml; group F: 5 x 107/ml. Significant differences (p < 0.01) were found for groups A, B, C, D, or E versus group F.

 

   Acknowledgements
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
References
 
This work was supported by grant BQ200020 [GenBank] from the Public Health Bureau, Jiangsu Province, P. R. China, and by grant SS200002 from the Social Development Plan, Scientific and Technological Council, Nanjing Municipality, P. R. China.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 

  1. Shaw BW. More questions than answers. Liver Transplant Surg 1995;1:404–407.[Medline]
  2. Everhart JE, Lombardero M, Detre KM, Zetterman RK, Wiesner RH, Lake JR, Hoofnagle JH. Increased waiting time for liver transplantation results in higher mortality. Transplantation 1997;64:1300–1306.[Medline]
  3. Bilsuttil W, Klintmalm B. Transplantation of the Liver. Saunders, Philadelphia, 1996; pp 861.
  4. Emond JC, Whitington PF, Thistlethwaite JR, Alonso EM, Broelsch CE. Reduced-size orthotopic liver transplantation: use in the management of children with chronic liver disease. Hepatology 1989;10:867–872.[Medline]
  5. Stockmann HB, Izermans JN. Prospects for the temporary treatment of acute liver failure. Eur J Gastroenterol Hepatol. 2002;14:195–203.[Medline]
  6. Boudjema K, Bachellier P, Wolf P, Tempe JD, Jaeck D. Auxiliary liver transplantation and bioartificial bridging procedures in treatment of acute liver failure. World J Surg 2002;26:264–274.[Medline]
  7. Sundback CA, Vacanti JP. Alternatives to liver transplantation: from hepatocyte transplantation to tissue-engineered organs. Gastroenterology 2000;228:438–442.
  8. Shito M, Kim NH, Baskaran H, Tilles AW, Tompkins RG, Yarmush ML, Toner M. In vitro and in vivo evaluation of albumin synthesis rate of porcine hepatocytes in a flat-plate bioreactor. Artif Organs 2001;25:571–578.[Medline]
  9. Kobayashi N, Okitsu T, Maruyama M, Totsugawa T, Kosaka Y, Hayashi N, Nakaji S, Tanaka N. Development of a cellulose-based microcarrier containing cellular adhesive peptides for a bioartificial liver. Transplant Proc 2003;35:443–444.[Medline]
  10. Gao Y, Xu XP, Hu HZ, Yang JZ. Cultivation of human liver cell lines with microcarriers acting as biological materials of bioartificial liver. World J Gastroenterol 1999;5:221–224.[Medline]
  11. Xue YL, Zhao SF, Luo Y, Li XJ, Duan ZP, Chen XP, Li WG, Huang XQ, Li YL, Cui X, Zhong DG, Zhang ZY, Huang ZQ. TECA hybrid artificial liver support system in treatment of acute liver failure. World J Gastroenterol 2001;7:826–829.[Medline]
  12. MacDonald JM, Wolfe SP, Roy-Chowdhury I, Kubota H, Reid LM. Effect of flow configuration and membrane characteristics on membrane fouling in a novel multicoaxial hollow-fiber bioartificial liver. Ann NY Acad Sci 2001;944:334–343.[Medline]
  13. Nara M, Hakamada K, Totsuka E, Nozaki T, Takiguchi M, Sasaki M. Efficacy of double filtration plasmapheretic cross-circulation using a high permeability membrane between totally hepatectomized dogs and donor pigs. Transplantation 2001,15:1736–1742.
  14. Benoist S, Sarkis R, Chafai N, Barbu V, Honiger J, Lakehal F, Becquemont L, Baudrimont M, Capeau J, Housset C, Nordlinger B. Survival and differentiation of porcine hepatocytes encapsulated by semiautomatic device and allotransplanted in large number without immunosuppression. J Hepatol 2001;35:208–216.[Medline]
  15. Catapano G, Euler M, Gaylor JDS, Gerlach J. Characterization of the distribution of matter in hybrid liver support devices where cells are cultured in a 3-D membrane network or on flat substrata. Int J Artif Organs 2001;24:102–109.[Medline]
  16. Gerlach JC. Development of a hybrid liver support system: a review. Int J Artif Organs 1996;19:645–654.[Medline]
  17. Tilles AW, Berthiaume F, Yarmush ML, Toner M. Critical issues in bioartificial liver development. Technol Health Care 2002;10:177–186.[Medline]
  18. Sauer IM, Obermeyer N, Kardassis D, Theruvath T, Gerlach JC. Development of a hybrid liver support system. Ann NY Acad Sci 2001;944:308–319.[Medline]
  19. Berry MN, Friend DS. High yield preparation of isolated rat liver parenchymal cells. J Cell Biol 1969;43:506–520.[Abstract/Free Full Text]
  20. Seglen PO. Preparation of isolated rat liver cells. Methods Cell Biol. 1976,13:23–28.
  21. Roger V, Balladur P, Honiger J, Baudrimont M, Delelo R, Robert A, Calmus Y, Capeau J,Nordlinger B. Internal bioartificial liver with xenogeneic hepatocytes prevents death from acute liver failure: An experimental study. Ann Surg 1998,228:1–7.[Medline]
  22. Siva JM, Day SH, Nicoll-Griffith DA. Induction of cytochrome-P450 in cryopreserved rat and human hepatocytes. Chem Biol Interact 1999;121:49–63.[Medline]
  23. Tong JZ, De Lagausie P, Furlan V, Bernard O, Alvarez F. Long term culture of adult rat hepatocyte spheroids. Exp Cell Res 1992;200:326–332.[Medline]
  24. Burchell A, Hume R, Burchell B. A new microtechnique for analysis of the human hepatic microsomal glucose-6-phosphatase system. Chin Chim Acta 1988;173:183–192.
  25. Morsiani E, Brogli M, Galavotti D, Pazzi P, Puviani AC, Azzena GF. Biologic liver support: optimal cell source and mass. Int J Artif Organs 2002;25:985–993.[Medline]
  26. Liu J, Jauregui HO, Faris RA, Santangini HA, Trenkler DM, Silva PG, Garcia KM. Growth and metabolic activity of immortalized porcine hepatocytes in extracorporeal hollow-fiber liver assist devices. Artif Organs 2001;25:539–545.[Medline]
  27. Kobayashi N, Noguchi H, Watanabe T, Matsumura T, Totsugawa T, Fujiwara T, Tanaka N. A tightly regulated immortalized human fetal hepatocyte cell line to develop a bioartificial liver. Transplant Proc 2001;33:1948–1949.[Medline]
  28. Hui T, Rozga J, Demetriou AA. Bioartificial liver support. J Hepatobiliary Pancreat Surg 2001;8:1–15.[Medline]
  29. Jasmund I, Langsch A, Simmoteit R, Bader A. Cultivation of primary porcine hepatocytes in an OXY-HFB for use as a bioartificial liver device. Biotechnol Prog 2002;18:839–846.[Medline]
  30. Morsiani E, Pazzi P, Puviani AC, Brogli M, Valieri L, Gorini P, Scoletta P, Marangoni E, Ragazzi R, Azzena G, Frazzoli E, Di Luca D, Cassai E, Lombardi G, Cavallari A, Faenza S, Pasetto A, Girardis M, Jovine E, Pinna AD. Early experiences with a porcine hepatocyte-based bioartificial liver in acute hepatic failure patients. Int J Artif Organs 2002;25:192–202.[Medline]
  31. Rozga J, Holzman MD, Ro MS, Griffin DW, Neuzil DF, Giorgio T, Moscioni AD, Demetriou AA. Development of a hybrid bioartificial liver. Ann Surg 1993;217:502–511.[Medline]
  32. Pahernik SA, Thasler WE, Doser M, Gomez-Lechon MJ, Castell MJ, Planck H, Koebe HG. High density culturing of porcine hepatocytes immobilized on nonwoven polyurethane-based biomatrices. Cells Tissues Organs 2001;168:170–177.[Medline]
  33. Sielaff TD, Nyberg SL, Rollins MD, Hu MY, Amiot B, Lee A, Wu FJ, Hu WS, Cerra FB. Characterization of the three-compartment gel-entrapment porcine hepatocyte bioartificial liver. Cell Biol Toxicol 1997;13:357–364.[Medline]
  34. Chen Z, Ding Y, Zhang H. Cryopreservation of suckling pig hepatocytes. Ann Clin Lab Sci 2001;31:391–398.[Abstract/Free Full Text]
  35. Soussi T. The p53 tumor suppressor gene: from molecular biology to clinical investigation. Ann NY Acad Sci 2000;910:121–137.[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, Q.
Right arrow Articles by Ding, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, Q.
Right arrow Articles by Ding, Y.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS