ACLS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, Y.
Right arrow Articles by Wang, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, Y.
Right arrow Articles by Wang, Y.
Annals of Clinical & Laboratory Science 32:292-298 (2002)
© 2002 Association of Clinical Scientists

Ketamine Reduces NF{kappa}B Activation and TNF{alpha} Production in Rat Mononuclear Cells Induced by Lipopolysaccharide In Vitro

Yingqun Yu1, Zhiqiang Zhou1, Jianguo Xu1, Zhihai Liu2 and Yu Wang3
1 Departments of Anesthesiology, 2 Surgery, and 3 Pharmacology, Jinling Hospital and Nanjing University School of Medicine, Nanjing, China

Address correspondence to Jianguo Xu, M.D., Department of Anesthesiology, Jinling Hospital, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province, P. R. China; tel 86 25 482 7974; fax 86 25 361 1675; Email: xujguo{at}publicl.ptt.js.cn


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ketamine may be advantageous for anesthesia of patients with sepsis caused by gram-negative bacteria, because ketamine may suppress LPS-induced production of proinflammatory cytokines, such as TNF{alpha} and IL-6. NF{kappa}B is an important transcription factor that is involved in the post-transcriptional regulation of mRNA expression for several immunoinflammatory mediators in response to endotoxemia. This study examined the effect of ketamine on NF{kappa}B activation and TNF{alpha} production in rat peripheral blood mononuclear cells (PBMC). The PBMC were incubated in the presence or absence of LPS and with graded concentrations of ketamine. The culture supernatants and cells were collected for each group and duration of incubation. Activation of NF{kappa}B was determined by electrophoretic mobility shift assay (EMSA), and the expression of I{kappa}B{alpha}, its inhibitor, in PBMC was analysed by Western blotting. TNF{alpha} levels in the supernatants were measured using a specific enzyme-linked immunosorbent assay (ELISA). LPS stimulation of rat PBMC increased TNF{alpha} production and NF{kappa}B activation, with corresponding loss of I{kappa}B{alpha}. Ketamine significantly reduced the LPS-induced NF{kappa}B activation and inhibited TNF{alpha} production in a dose-dependent manner. These in vitro findings suggest that ketamine is a potent inhibitor of NF{kappa}B activation and cytokine production in rat PBMC.

(received 8 November 2002; accepted 8 February 2002)

Keywords: ketamine, nuclear factor-{kappa}B, tumor necrosis factor-{alpha}, mononuclear cells, endotoxemia


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ketamine, an N-methyl-D-aspartate (NMDA) receptor antagonist, can increase systemic vascular resistance and cause cardiovascular stimulating effects, which may be advantageous in the anesthesia of patients with sepsis caused by gram-negative bacteria [1]. In cultured human whole blood, ketamine suppresses the production of LPS-induced proinflammatory cytokines, such as TNF{alpha} and IL-6 [2,3], which promote inflammatory processes and play important roles in the pathogenesis of sepsis.

Nuclear factor-{kappa}B (NF{kappa}B)[4,5] is an important regulation factor involved in the transcription of cytokine genes for immunoinflammatory mediators (IL-1, IL-6, IL-8), cell adhesion molecules, and immunoreceptors (eg, platelet-activating factor receptor) in response to endotoxemia. Latent NF{kappa}B is localized in the cytoplasm bound to its inhibitor, I{kappa}B. When cells are stimulated with LPS or other mediators (eg, cytokines, viral infections, reactive oxygen species), I{kappa}B becomes phosphorylated and degraded, resulting in NF{kappa}B activation. Free NF{kappa}B translocates to the nucleus, binds to specific sites in the promoter region of target genes, and stimulates transcription [68], resulting in TNF{alpha} production and release.

Since ketamine can inhibit the production of proinflammatory cytokines and since NF{kappa}B is critical for regulating the genes involved in immune and stress responses, we hypothesized that the effects of ketamine relating to decreased TNF{alpha} production might be due to inhibition of NF{kappa}B activation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chemicals and reagents.  Ketamine was purchased from Hengrei Pharmaceutical (Jiangsu Province, China). Phenol-extracted Escherichia coli (serotype O55:B5) LPS was purchased from Sigma (St Louis, MO, USA). The concentration of TNF{alpha} in the culture supernatant was determined by a rat TNF{alpha} specific enzyme-linked immunosorbent assay (ELISA) kit (Diaclone, Besanson Cedex, France).

Animals.  The experiments were approved by the Institutional Animal Care and Use Committee of Nanjing University. Male Sprague-Dawley rats weighing 200–300 g were used in these experiments.

Collection of peripheral blood mononuclear cells.  After rats were anesthetized with pentobarbital (40 mg/kg, ip), blood samples were collected by cardiac puncture into heparinized syringes. The peripheral blood mononuclear cells (PBMC) were purified using lymphocyte separation medium (ICN Co., USA). Following centrifugation (1500 x G, 30 min, room temperature), PBMC located at the interface were harvested and washed 2x with complete RPMI-1640 medium (Gibco, USA); the PBMC were then resuspended in the medium (1 x 106 cells/ml).

Cell culture and treatments.  The PBMC were cultured and treated in RPMI-1640 medium supplemented with 10% heated-inactivated fetal bovine serum (HyClone, Logan, UT, USA), glutamine (2 mM), penicillin (100 U/ml), and streptomycin (100 µg/ml). Cells were cultured overnight in 24-well dishes (1 x 106 cells/ml) at 37°C with 5% CO2. Thereafter, LPS (10 µg/ml) with or without ketamine (1, 10, 100, 1000, 5000 µM) was added and the incubation was continued for 1, 4, or 6 hr. To assess the effect of ketamine on PBMC viability, 5000 µM of ketamine was added to one 24-well dish and the cells were incubated as described above. The cells were then stained with 0.2% trypan blue, and cell survival was assessed by microscopy.

Preparation of nuclear and cytosolic extracts.  One hr after incubation, the PBMC (1 x 107 cells/ml) were harvested and washed 2x with ice-cold phosphate-buffered saline (PBS) and subsequently lysed in 800 µl of hypotonic buffer A (10 mM Hepes (pH 7.9), 10 mM KCl, 2 mM MgCl2, 0.1 mM EDTA, 1 mM dithiothreitol (DTT), and 0.5mM phenylmethylsulfonyl fluoride) on ice for 15 min. After addition of 50 µl of 10% (v/v) Nonidet P-40, the mixture was vigorously mixed and centrifuged for 10 min at 12000 rpm. The resulting supernatants were collected as the cytosolic extract, and the pelleted nuclei were resuspended in 50 µl of buffer B (50 mM Hepes (pH 7.9), 50 mM KCl, 300 mM NaCl, 0.1 mM EDTA,1 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, and 10% (v/v) glycerol). The suspension was incubated on ice for 20 min with intermittent mixing and centrifuged for 5 min at 12000 rpm. The supernatant was saved as nuclear extract. The protein content of the extract was determined by the Bradford method.

Western blot analysis for I{kappa}B.  Cytosolic extracts (30 µg protein/lane) were subjected to 10% SDS-polyacrylamide gel electrophoresis (PAGE) under nonreducing conditions and transferred to a nitro-cellulose membrane at 100 V for 1 hr. Low molecular protein molecular weight marker (Pharmacia, USA) was used as standard. The membrane was then blocked in Tris-buffered saline/Tween 20 (TBST) (20 mM Tris-HCl (pH 7.6), 150 mM NaCl, 0.1% Tween 20) containing 5% nonfat milk for 1 hr. Immunoblot detection was performed with primary antibody for I{kappa}Ba (kindly provided by Dr. W. C. Greene, The J. Gladstone Institute, San Fransciso, CA, USA) in a 1:2000 dilution overnight at 4°C. After washing (3x, 5 min) with TBST, the membrane was incubated with horseradish peroxidase-conjugated anti-rabbit IgG antibody (Boster Biotechnology, Wuhan, China) in a 1:2000 dilution (1 hr, room temperature). The membrane was again washed (3x, 10 min) in TBST, and the specific bands were visualized with enhanced chemiluminescent-Western blotting detection reagents (Pierce Biochemicals, USA).

Electrophretic mobility shift assay.  EMSA was performed with a kit (Promega, USA). Briefly, 1.75 pmol of oligonucleotide, labeled with [{gamma}-32P]-ATP (Yahui Biotech, Beijing, China) by incubation with 10 units of T4 polynucleotide kinase at 37°C for 10 min in a kinase buffer (700 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT). The reaction was stopped by adding 1 µl of 0.5 M EDTA. Cold competitor assays were carried out by adding a 100-fold molar excess of unlabeled probe or unlabeled modified probe 10 min prior to the addition of the labeled probe. Nuclear protein (5 µg) was preincubated in 9 µl of binding buffer for 10 min at room temperature followed by addition of the 32P-labeled oligonucleotide probe. Incubation was continued for 20 min. The resulting DNA-protein complexes were electrophoresed on 5% nonreducing polyacrylamide gel at 300 V in 0.5-x Tris-borate-EDTA. The gel was dried and autoradiographed. The following oligonucleotides were used:

NF{kappa}B: 5'AGTTGAGGGGACTTTCCCAGGC3', modified NF{kappa}B: 5'AGTTGAGTTGACTTTCCCACGC3'.

Statistics.  Data were expressed as mean ± SE. Statistical analyses were performed by ANOVA followed by Newman-Keul’s test. Significance was defined as p <0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Western blot analysis for I{kappa}B{alpha}.  NF{kappa}B exists in the cytoplasm in an inactive form complexed with a family of inhibitor proteins termed I{kappa}B (I{kappa}B{alpha}, I{kappa}Bß, I{kappa}B{varepsilon}), of which I{kappa}B{alpha} is the best studied. When cells are exposed to appropriate NF{kappa}B activators, I{kappa}B{alpha}is phosphorylated at its N-terminal and degraded, resulting in NF{kappa}B activation and translocation into the cell nucleus. The effect of ketamine on cytoplasmic I{kappa}B{alpha} levels in LPS-treated PBMC is illustrated in Fig 1Go. As expected, Western blots of the cytosolic proteins from control cells showed the presence of I{kappa}B{alpha} at baseline. LPS stimulation led to degradation of I{kappa}Ba. The I{kappa}B{alpha} level was increased in PBMC that were treated with LPS plus various concentrations of ketamine, but the dose-dependent response was not evident when >10 µM ketamine was added (Fig. 1Go).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. Western blot immunoassay for I{kappa}B{alpha}. Rat PBMC were stimulated for 1 hr with LPS (10 µg/ml) with or without graded additions of ketamine. Lane 1: nonstimulated; Lane 2: stimulated by LPS; Lane 3: stimulated by LPS in the presence of 1 µM ketamine; Lane 4: LPS plus 10 µM ketamine; Lane 5: LPS plus 100 µM ketamine; Lane 6: LPS plus 1000 µM ketamine; Lane 7: LPS plus 5000 µM ketamine. These results are typical of 3 separate experiments.

 
Effect of ketamine on NF{kappa}B activation.  EMSA experiments were performed to investigate the effect of ketamine on NF{kappa}B activation induced by LPS. Incubation of PBMC with LPS caused marked activation of NF{kappa}B, while simultaneous incubation with ketamine suppressed NF{kappa}B activation. Partial inhibition was detected at 1 µM ketamine, while inhibitory effects of ketamine were clearly evident at 10–5000 µM (Fig. 2Go). These results show that ketamine is a potent inhibitor of NF{kappa}B.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 2. Effect of ketamine on NF{kappa}B activation. PBMC were treated with LPS (10 µg/ml) for 1 hr with graded concentrations of ketamine. Nuclear proteins were then prepared for gel-shift analysis. Lane 1: nonstimulated; Lane 2: stimulated by LPS; Lane 3: stimulated by LPS in the presence of 1 µM ketamine; Lane 4: LPS plus 10 µM ketamine; Lane 5: LPS plus 100 µM ketamine; Lane 6: LPS plus 1000 µM ketamine; Lane 7: LPS plus 5000 µM ketamine. These results are typical of 3 separate experiments.

 
The NF{kappa}B band disappeared in the presence of 100-fold excess of unlabeled NF{kappa}B probe, but was unaffected by the unlabeled modified NF{kappa}B probe. These results indicate that the NF{kappa}B probe specifically bound to activated NF{kappa}B (Fig. 3Go).



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 3. Results of competitive electrophoretic mobility shift assay for NF{kappa}B activity. Lane 1: no nuclear extract; Lane 2: nuclear extract plus NF{kappa}B probe; Lane 3: nuclear extract plus 100-fold unlabeled NF{kappa}B probe; Lane 4: nuclear plus 100-fold unlabeled modified NF{kappa}B probe.

 
Effect of ketamine on TNF{alpha} production.  PBMC were treated with 10 µg/ml LPS alone or with increasing ketamine concentrations (1–5000 µM). Cell-free supernatants were harvested after 1, 4, and 6 hr and stored at -70°C . The TNF{alpha} concentration of each sample was measured with ELISA kits; all assays were performed in duplicate. As shown in Fig. 4Go, LPS stimulation led to a statistically significant increase of TNF{alpha}release; when rat PBMC were incubated for 6 hr, LPS-induced TNF{alpha}production increased from 309 ± 60 pg/ml to 1566 ± 52 pg/ml.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Effect of ketamine on TNF{alpha} production in rat PBMC. Cells were treated with graded concentrations of ketamine plus LPS (10 µg/ml), and TNF{alpha} levels were measured in the supernatant after 1, 4, and 6 hr. Values are the mean ± SE of 3 separate experiments. * p <0.05 vs LPS-treated PBMC.

 
Ketamine inhibited TNF{alpha} release in a dose-dependent manner at concentrations from 1 to 5000 µM when the ketamine was added at the same time as LPS. For example, 1, 10, 100, 1000, and 5000 µM ketamine caused respectively 29, 47, 56, 66, and 73% suppression of TNF{alpha} secretion stimulated by 10 µg/ml LPS for 4 hr (Fig. 4Go). Ketamine showed no effect on rat PBMC viability, as assessed by the exclusion of trypan blue.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ketamine is used in clinical practice for various forms of anesthesia, especially for hypovolemic shock and sepsis, because of its cardiovascular stimulating effects [1,9]. Some studies suggest that induction of anesthesia with ketamine could produce cardiovascular depression [10,11], but recent evidence indicates that ketamine suppresses the production of proinflammatory cytokines, including TNF{alpha}, IL-1, and IL-6 [2,12,13], in LPS-treated human whole blood and in plasma of endotoxin-treated rats, and inhibits LPS-induced nitric oxide production by rat macrophages [14], which are in agreement with its beneficial effect in sepsis.

There is little information on the mechanism of the suppressive effect of ketamine on cytokine production and on signal transduction pathways. Sakai et al [15] reported that ketamine suppressed endotoxin-induced NF{kappa}B expression in human glioma cells in vitro and in intact mouse brain in vivo. They suggested that this might be a mechanism for the neuroprotective effects of ketamine, but they did not investigate NF{kappa}B activation in relation to the production of proinflammatory cytokines.

In this study, we showed that ketamine suppressed LPS-induced NF{kappa}B activation in LPS-stimulated rat PBMC. Our Western blot immunoassays for I{kappa}B{alpha} showed congruent results. Additionally, to see whether these changes in transcriptional regulation correlated with cytokine production, we collected the supernatant from cultured cells. Fig. 3Go shows that TNF{alpha} production increased significantly upon LPS stimulation, compared to controls. Ketamine suppressed TNF{alpha} production in rat PBMC in a dose-dependent manner.

The current findings suggest a mechanism for ketamine inhibition of LPS-induced proinflammatory cytokine production. The discordance between TNF{alpha} production and NF{kappa}B activation in our study suggests that ketamine may also interfere with other transcription factors that regulate TNF{alpha} production, such as AP-1 [16,17]. A previous study [18] showed that leukocyte NF{kappa}B activation was unrelated to elevated IL-6, IL-8 and soluble intercellular adhesion molecules in critically ill patients, and suggested that NF{kappa}B was not the only transcription factor for these cytokines. The effect of ketamine on the synergistic interaction of NF{kappa}B with other transcription factors will be a subject for future investigations.

Common clinical dosages for ketamine in humans range from 0.5 to 10 mg/kg iv, with resultant plasma concentrations of 60–80 µM [19,20]. The concentrations of ketamine used in this in vitro study are similar to those used clinically. It has been demonstrated that ketamine significantly suppressed LPS-induced TNF{alpha} production in a dose-dependent manner at concentrations of 20–500 µg/ml (73–365 µM), but concentrations <4 µg/ml ketamine had no effect on LPS-induced TNF{alpha} production. Furthermore, at concentrations <20 µg/ml ketamine had no effect on IL-6 or IL-8 production in human whole blood after 6 hr incubation [2].

Royblat et al [21,22] reported that a subanesthetic dose of ketamine suppressed IL-6 production in women undergoing hysterectomy and a single dose of ketamine 0.25 mg/kg, administered before cardiopulmonary bypass, attenuated the increase of IL-6 during and after coronary artery bypass surgery. In our study, we showed that a concentration as low as 1 µM ketamine suppressed LPS-induced TNF{alpha} production, although larger doses of ketamine may be needed to suppress IL-6, IL-8 and other proinflammatory cytokine production [2,14,23].

Lewis et al [24] showed that large ketamine concentrations exerted anti-inflammatory activity, which was attributed to its cytostatic activity on a variety of cell types and cell functions; they recommended that to show anti-inflammatory effects, the ketamine concentrations should not exceed the upper anesthetic plasma level of 2.0 µg/ml. Based on our data, we suggest that a low dose of ketamine, coadministered with other anesthetics, such as propofol or opioids, may be used for sedation and analgesia, and at the same time, exert its anti-inflammatory effects.

In conclusion, we have shown that ketamine reduces NF{kappa}B activation and TNF{alpha} production in LPS-treated rat PBMC. These findings suggest that use of ketamine as an anesthetic agent may provide beneficial effects in endotoxemia, if appropriate doses are used.


    Acknowledgment
 
We thank Dr. W. C. Greene of The J. Gladstone Institute, San Fransciso, CA, USA, for donating the rabbit anti-I{kappa}B{alpha} antibody that was used in this investigation.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Yli-Hankala A, Kirvelä M, Randell T, Lindgren L. Ketamine anesthesia in a patient with septic shock. Acta Anaesthesiol Scand 1992;36:483–485.[Medline]
  2. Kawasaki T, Ogata M, Kawasaki C, Ogata J. Ketamine suppresses proinflammatory cytokine production in human whole blood. In Vitro. Anesth Analg 1999; 89:665–669[Abstract/Free Full Text]
  3. Larsen B, Hoff G, Wilhelm W, Buchinger H, Wanner GA, Baucer M. Effect of intravenous anesthetics on spontaneous and endotoxin-stimulated cytokine response in cultured human whole blood. Anesthesiology 1998;89:1218–1227.[Medline]
  4. Verma LM, Stevenson JK, Schwarz EM, van Atwerp D, Miyamoto S. Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev 1995; 9:2723–2735.[Free Full Text]
  5. Abraham E. NF-{kappa}B activation. Crit Care Med 2000; 28(Suppl.):N100–N104.[Medline]
  6. Zhong H, Suyang H, Erdjument-Bromage H, Tempst P, Ghosh S. The transcriptional activity of NF-kappaB is regulated by the IkappaB-associated PKAc subunit through a cyclic AMP-independent mechanism. Cell 1997;89:413–424.[Medline]
  7. Ghosh S, Baltimore D. Activation In Vitro of NF-{kappa}B by phosphorylation of its inhibitor I{kappa}B. Nature 1990;344:678–682.[Medline]
  8. Baeuerle PA, Baltimore D. Activation of DNA-binding activity in an apparently cytoplasmic precursor of the NF-kappa B transcription factor. Cell 1988;53:211–217.[Medline]
  9. Lippmann M, Appel PL, Mok MS, Shoemaker WC. Sequential cardiorespiratory patterns of anesthetic induction with ketamine in critically ill patients. Crit Care Med 1983;11:730–734.[Medline]
  10. Allen DG, Dyson DH, Pascoe PJ, O’Grady MR. Evaluation of a xylazine-ketamine hydrochloride combination in the cat. Can J Vet Res 1986; 50:23–26.[Medline]
  11. Blake DW, Blomberg PA, Korner PI. Effect of ketamine, althesin, and thiopentone on the Valsalva-constrictor and heart rat reflexes of the rabbit. J Auton Nerv Syst 1982;5:291–301.[Medline]
  12. Koga K, Ogata M, Takenaka I, Matsumoto T, Shigematsu A. Ketamine suppresses tumor necrosis factor-{alpha} activity and mortality in carrgeenan-sensitized endotoxin shock model. Cir Shock 1995; 44:160–168.
  13. Taniguchi T, Shibatta K, Yamamoto K. Ketamine inhibits endotoxin-induced shock in rat. Anesthesiology 2001,95:928–932.[Medline]
  14. Shimaoka M, Lida T, Ohara A, Taenaka N, Mashimo T, Honda T, Yoshiya T. Ketamine inhibits nitric oxide production in mouse-activated macrophage-like cells. Br J Anaesth 1996;77:238–242.[Abstract/Free Full Text]
  15. Sakai T, Ichiyama T, Whitten CW, Giesecke AH, Lipton JM. Ketamine suppresses endotoxin-induced NF-{kappa}B expression. Can J Anesth 2000;47:1019–1024.[Medline]
  16. Lee YW, Hennig B, Yao J, Toborek M. Meth-amphetamine induces AP-1 and NF-kappaB binding and transactivation in human brain endothelial cells. J Neurosci Res 2001;66:583–591.[Medline]
  17. Lee YW, Hennig B, Fiala M, Kim KS, Toborek M. Cocaine activates redox-regulated transcription factors and induces TNF-alpha expression in human brain endothelial cells. Brain Res 2001,920:125–133.[Medline]
  18. Paterson RL, Galley HF, Dhillon JK, Webster NR. Increased nuclear factor {kappa}B activation in critically ill patients who die. Crit Care Med 2000,28:1047–1051.[Medline]
  19. Wieber J, Gugler R, Hengstmann JH, Dengler HJ. Pharmacokinetics of ketamine in man. Anaesthetist 1975;24:260–263.[Medline]
  20. Idvall J, Ahlgren I, Aronsen KF, Stenberg P. Ketamine infusions: pharmacokinetics and clinical effect. Br J Anaesth 1979;51:1167–1172.[Abstract/Free Full Text]
  21. Roytblat L, Talmor D, Rachinsky M, Greemberg L, Pekar A, Appelbaum A, Gurman GM, Shapira Y, Duvdenani A. Ketamine attenuates the interleukin-6 response after cardiopulmonary bypass. Anesth Analg 1998;87:266–271.[Abstract/Free Full Text]
  22. Roytblat L, Roy-Shapira A, Greemberg L, et al. Preoperative low dose ketamine reduces serum interleukin-6 response after abdominal hysterectomy. Pain Clin 1996;9:327–334.
  23. Li CY, Chou TC, Wong CS, Ho ST, Wu CC, Yen MH, Ding YA. Ketamine inhibits nitric oxide synthase in lipopolysaccharide-treated rat alveolar macrophages. Can J Anaesth 1997;44:989–995.[Medline]
  24. Lewis E, Rogacher B, Shaked G, Douvdevani A. The in vitro effects of ketamine at large concentrations can be attributed to a nonspecific cytostatic effect. Anesth Analg 2001;92:927–929.[Free Full Text]



This article has been cited by other articles:


Home page
Anesth. Analg.Home page
R. Gurfinkel, D. Czeiger, A. Douvdevani, Y. Shapira, A. A. Artru, Y. Sufaro, J. Mazar, and G. Shaked
Ketamine improves survival in burn injury followed by sepsis in rats.
Anesth. Analg., August 1, 2006; 103(2): 396 - 402, table of contents.
[Abstract] [Full Text] [PDF]


Home page
Ann Clin Lab SciHome page
J. Sun, F. Li, J. Chen, and J. Xu
Effect of Ketamine on NF-kappa B Activity and TNF-alpha Production in Endotoxin-Treated Rats
Ann. Clin. Lab. Sci., April 1, 2004; 34(2): 181 - 186.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, Y.
Right arrow Articles by Wang, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, Y.
Right arrow Articles by Wang, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS