ACLS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cha, J.-y.
Right arrow Articles by Ahn, Y.-h.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cha, J.-y.
Right arrow Articles by Ahn, Y.-h.
Annals of Clinical & Laboratory Science 32:114-122 (2002)
© 2002 Association of Clinical Scientists

Analysis of Polymorphism of the GLUT2 Promoter in NIDDM Patients and its Functional Consequence to the Promoter Activity

Ji-young Cha1, Hyon-suk Kim2, Ha-il Kim1, Seung-soon Im1, So-youn Kim1, Jae-woo Kim1, Byung-il Yeh1 and Yong-ho Ahn1
1 Department of Biochemistry & Molecular Biology and Institute of Genetic Science, and
2 Department of Clinical Pathology, Yonsei University College of Medicine, Seoul, Korea

Address correspondence to Yong-ho Ahn, M.D., Ph.D., Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-752, Korea; tel 82 2 361 5182; fax 82 2 312 5041; e-mail yha111{at}yumc.yonsei.ac.kr.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Glucose transporter type 2 (GLUT2), along with glucokinase, has been implicated to participate in glucose-induced insulin secretion in pancreatic ß-cells. Recently, several sequence variations in the promoter of GLUT2 have been identified in patients with non-insulin dependent diabetes mellitus (NIDDM), but the functional effects of these polymorphisms on promoter activity have not previously been studied. We compared the incidence of sequence variations in the GLUT2 promoter in 100 normal subjects and 100 NIDDM patients. Sequencing of the promoter region (-294 to +301) revealed that an A->G variant at position -44 was found in 45 of 100 NIDDM patients, but only in 23 of 100 normal subjects. In addition, -269 A->C and +103 A->G mutations were identified in a single diabetic patient. Electrophoretic mobility shift assays using double-stranded oligonucleotide containing -44A as a probe showed a clearly shifted band of DNA-protein. To examine whether the sequence variation at position -44 affects the promoter activity, we carried out in vitro transfection experiments. Site-specific mutagenesis at position -44 region from A to C, T, or G resulted in reductions of CAT activity by 52.3%, 63.8%, and 63.6%, respectively. The -269 A->C and +103 A->G mutations also decreased the promoter activity. These results suggest that polymorphisms at positions -269, -44, or +103 may affect GLUT2 gene transcription, possibly associated with reduced expression of the GLUT2 gene in NIDDM patients.

(received 7 December 2001; accepted 22 December 2001)

Keywords: glucose transporter type 2, gene polymorphisms, noninsulin dependent diabetes mellitus


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Non-insulin dependent diabetes mellitus (NIDDM) is a heterogeneous polygenetic disorder characterized by a defect in glucose-induced insulin secretion and insulin action on target tissues [1]. Recently, efforts have been focused on identifying genes that may be associated with the development of NIDDM [2]. Genetic defects that determine the susceptibility to NIDDM have been identified in the insulin [3], insulin receptor [4], and glucokinase genes [5].

Glucose uptake into cells is mediated by a family of glucose transporters [6]. Of these, the GLUT2 glucose transporter isoform is known to be responsible for glucose entry into hepatocytes, pancreatic ß-cells, and absorptive epithelial cells in the intestinal mucosa and proximal tubule of the kidney [7–10]. Particularly in pancreatic ß-cells, high Km glucokinase and GLUT2 are considered to be important components of the ß-cell glucose-sensing apparatus [11]. Johnson et al [12] reported under-expression of GLUT2 in diabetes, possibly due to reduced transcription. Thus, GLUT2 is a candidate gene for which mutations in exons or promoter regions may lead to the development of NIDDM. In autoimmune diabetic BB rats [13] and Zucker diabetic fatty rats [14], the primary defect of GLUT2 expression may be related to a secretory defect of insulin by ß-cells. The decreased expression appears to be related to a secondary effect of diabetes mellitus in other experimental models [15]. The differences of glucose transporter expression in various diabetes models are believed to reflect the heterogeneity of NIDDM [16].

At least in human models, population studies and linkage analyses indicate that GLUT2 defects do not play a role in the pathogenesis of NIDDM [17,18]. However, Mueckler et al [19] reported that mutation of Val197-Ile abolished the glucose transporter activity; they suggested that mutation in the exon region may be causally involved in the pathogenesis of NIDDM, although a mutation in the exon region cannot account for the decreased GLUT2 transcription. Therefore, there is a possibility that a functional mutation in the promoter region may affect GLUT2 gene expression.

The genetic variation of the GLUT2 promoter in relation to the development of NIDDM has recently been evaluated in the Danish population [20]. No evidence was found to support the hypothesis that genetic variation in the promoter of GLUT2 may predispose to prediabetic phenotypes or type 2 diabetes.

In the present study, we amplified and sequenced the human GLUT2 promoter region from -294 to +301 using genomic DNA of normal Korean subjects and NIDDM patients. We found significant mutations in the promoter region and were able to demonstrate the functional significance of these mutations on GLUT2 promoter activity by an in vitro transfection experiment.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Acknowledgements
 References
 
Subjects.  Whole blood samples were collected from 100 patients with NIDDM and 100 normal control subjects. In the patients with NIDDM, the diagnosis of NIDDM was based on the World Health Organization’s criteria [21] and on hemoglobin A1c concentrations in the blood samples. In all cases, informed consent was obtained from the subject or a family member. These clinical studies were approved by the Ethics Committee of Severance Hospital, Yonsei University College of Medicine, Seoul, Korea.

DNA preparation and amplification of the human GLUT2 promoter region.  Blood samples were subjected to Ficoll-Hypaque® (Pharmacia, Uppsala, Sweden) centrifugation to separate peripheral lymphocytes. Whole genomic DNA was fractionated using the QIAamp Blood Kit® (Qiagen, Hilden, Germany). The genomic DNA samples were stored at 4°C for later use.

In order to amplify the promoter region of human GLUT2 gene, hGT2-5 primer (-294 ~ -275, sense, 5' TGCTT AAGCT TATAC TCCCC 3'), and hGT2-7 primer (+301 ~ +282, antisense, 5' GGAGT CCTGT GAATT CCAGG 3') were used. The G at -286 position (within sense primer) and C at +291 (within antisense primer) were replaced with C and G to introduce Hind III and EcoR I sites for subcloning, respectively.

PCR amplification was performed in 50 µl containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 15 pmoles of each primer, 100 mM of dNTP mix, 0.01% gelatin, and 1.5 units of ExTaq DNA polymerase (Takara, Japan). The reaction mixture was denatured for 3 min at 94°C, and went through 30 cycles of denaturation (94°C for 30 sec), annealing (55°C for 30 sec) and extension (72°C for 30 sec). At the final stage of PCR, the extension reaction was carried out at 72°C for 10 min.

Subcloning and pCAT3-H(-294) construction.  The general procedure for subcloning was carried out as described by Sambrook et al [22]. The amplified hGLUT2 DNAs (595 bp) from patient samples were isolated from agarose gel and purified using Gene Clean II kit® (Bio 101, Vista, CA). The amplified DNAs were then subcloned into pT7BlueT-vector® (Novagen, Madison, WI), the insert DNA was excised using EcoR I and Hind III, and the end made blunt using dNTPs and Klenow enzyme. The DNA was transferred to the Sma I site of pCAT3 basic vector® (Promega, Madison, WI) to measure the promoter strength. The orientation of the insert DNA was confirmed by DNA sequencing [23] using the T7 DNA sequencing kit® (Pharmacia) with primer (Promega, Madison, WI) annealing to the multiple cloning site of pCAT3 basic vector. The resulting recombinant DNA, which was named pCAT3-H(-294), was used in the transfection study.

DNA sequencing.  Direct PCR sequencing was performed according to the manufacturer’s protocol (Thermal Cycling Kit®, Perkin-Elmer, Norwalk, CT), and run in 8% denaturing polyacrylamide gel. For direct sequencing, hGT2-5, hGT2-8 (-122 ~ -101, sense, 5' TCCATGCTCCAGAGCACAGC 3'), and hGT2-9 (sense, +49~+68, 5' CCTAGTGGAACAAAGGTATT 3') were used as primers. The mutated sequences were confimed by means of an automatic sequence analyser (ALFwin Sequence Analyser 2.00, Amersham-Pharmacia Biotech).

Site specific mutagenesis of the human GLUT2 promoter region.  Wild type human GLUT2 promoter [H(-294)] was subjected to mutation using the Quickchange Mutagenesis Kit® (Stratagene). The oligonucleotides used for introducing mutations at specific sites of human GLUT2 promoter are summarized in Table 1Go. The mutagenesis reaction was performed by the manufacturer’s protocol. Briefly, the reaction was performed in 50 µl containing 10 mM KCl, 10 mM (NH4)2SO4, 20 mM Tris-HCl (pH 8.8), 2 mM MgSO4, 0.1% Triton X-100, 0.1 mg/ml nuclease free bovine serum albumin, 10 ng of pCAT-H(-294), 125 ng of primer sets, dNTP mix, and 2.5 units of Pfu DNA polymerase.


View this table:
[in this window]
[in a new window]
  		Table 1. Oligonucleotides used for site-specific mutagenesis experiments.
 
The reaction was carried out in a Thermal Cycler® (Perkin-Elmer) by denaturing at 95°C for 30 min. Subsequent 12 reaction cycles included denaturation at 95°C for 30 sec, annealing at 55°C for 1 min, and extension at 72°C for 12 min. After reaction, 10 units of Dpn I were added to the reaction mixture to digest methylated template DNA and used for transformation of E. coli XL1-Blue® (Stratagene). DNA sequences of mutants generated by the Quickchange kit were confirmed by DNA sequencing [23].

Electrophoretic mobility shift assay (EMSA).  Probes for gel shift assays were labeled with 32P in the presence of [{gamma}-32P]ATP and T4 polynucleotide kinase. Labeled double-stranded oligonucleotides were prepared by mixing a 5-fold molar excess of complementary single-stranded DNAs in 50 mM NaCl, heating to 90°C for 5 min, and cooling to room temperature.

The oligonucleotides that were used are listed at the top of the two panels in Fig. 1Go. Sp1 oligonucleotide was purchased from Promega. The labeled probe (50,000 cpm) was combined with nuclear proteins in 25 mM Tris/HCl, pH 7.4, 80 mM KCl, 0.1 mM EDTA, 1 mM dithiothreitol, and 10 % (v/v) glycerol. The nonspecific competitor, 1.5 µg of poly(dI-dC), was added to each binding raction. Binding reaction mixtures were incubated for 20 min on ice and resolved on a nondenatured (5% w/v) acrylamide gel [29:1 (w/w) acrylamide/bisacrylamide] in 0.5X TBE at 4°C. For competition assays, a 10- or 100-fold molar excess of various unlabeled competitor DNAs was added to the reaction mixture prior to the addition of the labeled probe. The dried gels were exposed to X-ray film at -70°C with an intensifying screen.




View larger version (74K):
[in this window]
[in a new window]
  		Fig. 1. Electrophoretic mobility shift assays of 44A and 269A oligonucleotides. The sequences of the oligonucleotides used are shown at the top (mutated nucleotides are underlined). In the left panel, 32P-labeled 44A was incubated with rat liver nuclear extract (5 or 10 µg) (lanes 2 and 3). The probe was incubated with 10 µg of the nuclear extract plus 10- or 100-fold molar excess of the indicated cold competitor: 44A (lanes 4 and 5), M3 (lanes 6 and 7), 44G (lanes 8 and 9). In the right panel, 32P-labeled 269A was incubated with rat liver nuclear extract (5 µg) in the absence (lane 2) or presence of 100-fold molar excess of the indicated cold competitors: 269A (lane 3), 269C (lane 4), 269G (lane 5), Sp1 (lane 6). The arrows indicate DNA-protein complexes.

 
Cell culture and transient transfection.  HIT-T15 cells, a pancreatic ß-cell line, were cultured in Ham’s F-12K media supplemented with 10% fetal calf serum, 2.5% dialyzed horse serum, and antibiotics (penicillin 100 units/ml, streptomycin 0.25 µg/ml, amphotericin B 0.0085%). Cells were maintained as monolayer cultures and grown in appropriate media. Plasmid DNAs were purified on Midiprep kit columns (Qiagen) three times, independently. For transfection, 20 µl of lipofectin (GIBCO, BRL, USA) and DNA mixture (5 µg of pCAT3-H(-294), or site-specific mutants) and 1 µg of CMV-ß-galactosidase were used. Transfection was performed according to manufacturer’s instruction. After a 16-hr incubation, the remaining lipofectin-DNA complexes in the culture fluid were removed and replaced with fresh Ham’s F-12K media and cultured another 72 hr.

ß-Galactosidase, protein, and CAT activity assays.  Cells were washed with phosphate buffered saline (PBS), scraped, resuspended in 100 µl of 0.25 M Tris-HCl (pH 7.8), and disrupted by freezing and thawing. The suspension of disrupted cells was centrifuged (12,000g, 5 min) and the supernatants were collected. Aliquots of 30 µl were used for measuring ß-galactosidase activity and the remainders were heated at 65°C for 10 min to inactivate deacetylase. Insoluble materials were removed by centrifugation at 12,000 g for 5 min and the supernatants were used for CAT assay [24]. Protein concentration was measured by the method of Bradford [25]. The CAT activities were normalized with respect to ß-galactosidase activity and protein concentration. The CAT activities were measured by a phosphoimaging system (BAS-2500, Fuji Photo Film Co, Tokyo, Japan) and the percent conversion to acetylated chloramphenicol was calculated.

Statistics.  All transfection studies were carried out in three separate experiments, each in triplicate. Data are expressed as means ± SD and compared by Student’s t-test or Fisher’s exact test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Acknowledgements
 References
 
Polymorphisms in human GLUT2 promoter.  Direct PCR sequencing of the human GLUT2 promoter region from 100 normal Korean subjects and 100 NIDDM patients showed sequence differences at positions -149(A) and -122(C), which were reported as C and T, respectively [1]. In addition, the nucleotide reported as G at position -44 [1] was found to be A in a majority of the samples. The nucleotide at position -44 was also reported to be A by the human genome project [www.ensembl.org, Ensembl gene ID: ENSG00000114308, sequences on AC068853 [GenBank] ]. Taken together, we regarded -44A as the wild type.

Examination of the sequences in the promoter region (-294 ~ +301) showed polymorphisms at positions -269, -44, and +103. Most variations observed at position -44 were in the mixed form of A/G. Table 2Go summarizes the frequencies of polymorphisms observed in the normal subjects and NIDDM patients. At position -44, the normal base A was present as A/G mixed form in 35 of 100 NIDDM patients. Also, the G homozygote form was found in 10 of 100 samples. Interestingly, one of the NIDDM patients who had A/G mixed bases also had mutations at positions -269 and +103, where bases A and A were changed to C and G, respectively. In normal subjects, 14% and 9% showed the A/G and G mutations, respectively.


View this table:
[in this window]
[in a new window]
  		Table 2. Analysis of the mutations at position -44 in the human GLUT2 promoter.
 
Electrophoretic mobility shift assay.  Considering high incidence of polymorphism at position -44 in NIDDM patients, we speculated that this region could play an important role in the regulation of transcription. To examine whether transcription factors bind to this region, we performed electrophoretic mobility shift assays using a double stranded oligonucleotide containing -44A as a probe. As shown in Fig. 1Go (left panel), a clearly shifted band of DNA-binding protein was found, suggesting that this region could participate in regulating transcription in vivo. Next, we determined the effect of mutations on the binding affinity of the protein with the probe (Fig. 1Go, left panel, lanes 6 – 9). Formation of the DNA-protein complex was inhibited by unlabeled 44A oligonucleotide, whereas it was only slightly inhibited by unlabeled 44G oligonucleotide. M3 (CAG->AGT) showed no competition, suggesting that the protein binding to 44A oligonucleotide is specific and has high affinity.

We also examined the protein binding ability of the region containing -269 or +103 by EMSA, although these mutations were detected in only one patient. Using oligonucleotide 269A as a probe, two shifted bands were observed by the addition of rat liver nuclear extracts (Fig. 1Go, right panel, lane 2). The DNA-protein complex was inhibited by an excess of unlabeled oligonucleotides 269A but not by 269C, 269G, or a nonspecific competitor, Sp1. In the case of position +103, we previously reported that HNF1 and HNF3 could bind at this region and regulate expression of the GLUT2 gene [26].

Site-specific mutagenesis of the human GLUT2 promoter.  Although the mutations in exon regions of GLUT2 gene are well known in NIDDM [16,27], the functional consequence of the promoter mutations in various diabetic states have not been established. To study the effects of mutations on the promoter activities, we carried out site-specific mutagenesis and transient transfection experiments. As shown in Fig. 2Go, mutant GLUT2 promoter showed remarkable reductions of CAT activity in HIT-T15 cells. The promoter activities of the mutants [A(-44)C, A(-44)T, and A(-44)G] were reduced by 52.3%, 63.8%, and 63.6%, respectively, when compared to those exerted by the wild type (p <0.05). The mutation at position -269 also showed reduction of CAT activity. The CAT activities shown by A(-269)C and A(-269)G mutants were reduced by 62.3% and 44.8%, respectively, when compared to the wild type (p <0.05). We previously reported that the G mutation at position +103 reduced GLUT2 promoter activity to 78% of wild type [26]. A triple mutant (#32–3), which contains mutations at -269, -44, and +103, showed marked reduction (75.7%) of CAT activity compared to wild type.



View larger version (18K):
[in this window]
[in a new window]
  		Fig. 2. Effect of site-specific mutations of the human GLUT2 promoter on CAT activity. The wild type pCAT3-H-294 was subjected to site-specific mutation. The resulting mutant promoter constructs were used for transient CAT activity assay in HIT-T15 cells. A(-44)C, A(-44)T, A(-44)G, A(-269)C, and A(-269)G represent the base changes introduced at the promoter region (numbers in the parentheses). Column #32-3 represents a promoter that has triple mutations at positions -269, -44, +103. CAT activity was assayed by exposing TLC plates to phosphoimaging enhancer plate for 2 hr. Data shown are the means ± SD of three separate experiments, each performed in triplicate.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Acknowledgements
 References
 
NIDDM is a multigenetic disorder characterized in part by inappropriate secretion of insulin in response to glucose. In many NIDDM animal models, impairment of glucose-induced insulin secretion is known to be associated with ß-cell GLUT2 expression [12,13,28). Therefore, it has been hypothesized that abnormal GLUT2 expression or mutation of the GLUT2 gene may contribute to the pathogenesis of diabetes mellitus. Of these possibilities, a correlation between a mutation within the coding sequence of GLUT2 and its functional consequences has been proven [18]. However, a possible mutation in the promoter region has not been shown to cause underexpression of this gene.

We reported that the expression of GLUT2 is regulated by several trans-acting factors, such as hepatocyte nuclear factors (HNF1, HNF3) [26], which bind at the +103 region of the human GLUT2 gene, peroxisomal proliferator activating factor (PPAR) [29], and CCAAT/enhancer binding protein (C/EBP) [30]. These transcription factors regulate several genes expressed in liver and pancreatic ß-cells by a complex network and defects of these factors cause many subtypes of maturity onset diabetes of the young (MODY) [31].

The goal of this study was to test the hypothesis that genetic variations of the GLUT2 promoter might play a role in decreased expression of this transporter in NIDDM patients. Significant numbers of NIDDM samples showed sequence variation at position -44, with heterozygous or homozygous polymorphism. One of the -44A/G mixed variant NIDDM patients had other mutations at positions -269 and +103, but this patient did not demonstrate distinctive diabetic complications. Considering that NIDDM is a multigenetic and heterogeneous disorder, the high incidence of sequence variation at position -44 could be regarded as unusual in the NIDDM patient population.

In order to prove a specific role of each region in respect to GLUT2 promoter activity, we performed DNA-protein binding and transient transfection assays. As shown in Fig. 1Go, nuclear proteins could bind to oligonucleotides 44A or 269A. For the 44A probe, formation of the DNA-protein complex was slightly inhibited by unlabeled 44G oligonucleotide, whereas the M3 mutant did not compete with the bound protein. For the 269A probe, two DNA-protein complexes were detected. Formation of these complex was not inhibited by mutated unlabeled oligonucleotides or by Sp1. These results show that the DNA-protein complexes are specific with each oligonucleotide. We performed DNA-based computer analysis of this region; however, there are no consensus sequences that match these regions. To characterize the protein, we are now attempting to purify the protein fraction using streptavidin magnetic beads conjugated with 44A oligonucleotides.

The base changes from A to C, T, or G at position -44 resulted in >50% decreases of the promoter activities (Fig. 2Go), suggesting that the -44 region of human GLUT2 promoter is critical in exerting promoter activity. Of the NIDDM cases, most mutations (35 cases) were present as the A/G mixed-form at position -44, while 10 cases showed the G mutation. If the A/G mixed-form is considered heterozygotic, the G mutation may be homozygotic to the locus, raising the possibility that the human GLUT2 promoter activity may be more severely deteriorated. However, we could not find any difference in diabetic symptoms that reflected the complications arising from NIDDM in relation to A/G or G mutations. Also, the mutations at position -269 (C or G) resulted in a decrease of the promoter activity, compared to the wild type. A triple mutant promoter containing -44, -269, and +103 mutations showed an additive effect in the reduction of promoter activity, suggesting the possibility that a wide range of combinational polymorphisms on the GLUT2 promoter may occur in the NIDDM population.

It was evident that the mutations at positions -44 or -269 of the human GLUT2 promoter resulted in decreases of GLUT2 gene expression. The higher prevalence of mutation at position -44 may explain the lowered GLUT2 transcriptional activity in NIDDM. Also, there is a possibility that normal subjects with GLUT2 promoter mutations may be susceptible to diabetes, because 23% of the normal subjects also showed variation at position -44. The significance of the mutations observed in normal subjects needs further study. At present, it is not known whether the normal subjects who had the A/G mixed-form or the G mutation may have a tendency to have lowered GLUT2 transcriptional activity and may develop NIDDM in the future.

This work is the first report of GLUT2 promoter mutations in relation to reduced transcriptional activity of the GLUT2 gene, which may explain the decreased gene activity in NIDDM patients or diabetes-prone normal subjects.


   Acknowledgements
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
References
 
This research was supported by a grant ( PF002106-01) from the Plant Diversity Research Center of the 21st Century Frontier Research Program, funded by the Ministry of Science and Technology of the Korean government. Ji-young Cha, Ha-il Kim, Seung-soon Im, and So-youn Kim received scholarships from the Brain Korea 21 Project For Medical Science, funded by the Ministry of Education of South Korea.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 

  1. Takeda J, Kayano T, Fukumoto H, Bell GI. Organization of the human GLUT2 (pancreatic beta-cell and hepatocyte) glucose transporter gene. Diabetes 1993;42:773–777.[Abstract]
  2. Permutt MA, Chiu KC, Tanizawa Y. Glucokinase and NIDDM. A candidate gene that paid off. Diabetes 1992;41:1367–1372.[Abstract]
  3. Steiner DF, Tager HS, Chan SJ, Nanjo K, Sanke T, Rubenstein AH. Lessons learned from molecular biology of insulin-gene mutations. Diabetes Care 1990;13:600–609.[Abstract]
  4. Taylor SI, Cama A, Accili D, et al. Mutations in the insulin receptor gene. Endocr Rev 1992;13:566–595.[Abstract/Free Full Text]
  5. Froguel P, Zouali H, Vionnet N, et al. Familial hyperglycemia due to mutations in glucokinase. Definition of a subtype of diabetes mellitus. New Engl J Med 1993;328:697–702.[Abstract/Free Full Text]
  6. Burant CF, Sivitz WI, Fukumoto H, et al. Mammalian glucose transporters: structure and molecular regulation. Recent Prog Horm Res 1991; 47:349–387.
  7. Fukumoto H, Seino S, Imura H, et al. Sequence, tissue distribution, and chromosomal localization of mRNA encoding a human glucose transporter-like protein. Proc Natl Acad Sci USA 1988;85:5434–5438.[Abstract/Free Full Text]
  8. Gould GW, Bell GI. Facilitative glucose transporters: an expanding family. Trends Biochem Sci 1990;15: 18–23.[Medline]
  9. Johnson JH, Newgard CB, Milburn JL, Lodish HF, Thorens B. The high Km glucose transporter of islets of Langerhans is functionally similar to the low affinity transporter of liver and has an identical primary sequence. J Biol Chem 1990;265:6548–6551.[Abstract/Free Full Text]
  10. Mueckler M. Facilitative glucose transporters. Eur J Biochem 1994;219:713–725.[Medline]
  11. Unger RH. Diabetic hyperglycemia: link to impaired glucose transport in pancreatic beta cells. Science 1991;251:1200–1205.[Abstract/Free Full Text]
  12. Johnson JH, Ogawa A, Chen L, et al. Under-expression of cell high Km glucose transporters in noninsulin-dependent diabetes. Science 1985;250: 546–549.
  13. Orci L, Ravazzola M, Baetens D, et al. Evidence that down-regulation of beta-cell glucose transporters in non-insulin-dependent diabetes may be the cause of diabetic hyperglycemia. Proc Natl Acad Sci USA 1990;87:9953–9957.[Abstract/Free Full Text]
  14. Orci L, Unger RH, Ravazzola M, et al. Reduced beta-cell glucose transporter in new onset diabetic BB rats. J Clin Invest 1990;86:1615–1622.
  15. Thorens B, Wu YJ, Leahy JL, Weir GC. The loss of GLUT2 expression by glucose-unresponsive beta cells of db/db mice is reversible and is induced by the diabetic environment. J Clin Invest 1992;90:77–85.
  16. Matsubara A, Tanizawa Y, Matsutani A, Kaneko T, Kaku K. Sequence variations of the pancreatic islet/liver glucose transporter (GLUT2) gene in Japanese subjects with noninsulin dependent diabetes mellitus. J Clin Endocrin Metab 1995;80;3131–3135.[Abstract]
  17. Patel P, Bell GI, Cook JTE, Turner RC, Wainscoat JS. Multiple restriction fragment length polymorphisms at the GLUT2 locus: GLUT2 haplotypes for genetic analysis of type 2 (non-insulin-dependent) diabetes mellitus. Diabetologia 1991;34:817–821.[Medline]
  18. Elbein SC, Hoffman MD, Matsutani A, Permut MA. Linkage analysis of GLUT1 (HepG2) and GLUT2 (liver/islet) genes in familial NIDDM. Diabetes 1992;41:1660–1667.[Abstract]
  19. Mueckler M, Kruse M, Strube M, Riggs AC, Chiu KC, Permutt MA. A mutation in the GLUT2 glucose transporter gene of a diabetic patient abolishes transport activity. J Biol Chem 1994; 269:17765–17767.[Abstract/Free Full Text]
  20. Moller AM, Jensen NM, Pildal J, et al. Studies of genetic variability of the glucose transporter 2 promoter in patients with type 2 diabetes mellitus. J Clin Endocrinol Metab 2001;86:2181–2186.[Abstract/Free Full Text]
  21. Diabetes Mellitus: Report of a WHO Study Group. WHO Tech Rep Ser 727, Geneva, 1985; pp 1–113.
  22. Sambrook J, Fritsch EF, Maniatis T. Strategies for cloning in plasmid vectors. In: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Woodbury, NY, 1989; vol 1, pp 53–73.
  23. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Biotechnology 1977;74:5463–5467.
  24. Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 1982;2:1044–1051.[Abstract/Free Full Text]
  25. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248–264.[Medline]
  26. Cha JY, Kim HI, Kim KS, Hur MW, Ahn YH. Identification of transacting factors responsible for the tissue-specific expression of human glucose transporter type 2 isoform gene. Cooperative role of hepatocyte nuclear factors 1alpha and 3beta. J Biol Chem 2000;275:18358–18365.[Abstract/Free Full Text]
  27. Shimada F, Makino H, Iwaoka H, et al. Identification of two novel amino acid polymorphisms in beta-cell/liver (GLUT2) glucose transporter in Japanese subjects. Diabetologia 1995;38:211–215.[Medline]
  28. Milburn JL, Ohneda M, Johnson JH, Unger RH. Beta-cell GLUT-2 loss and non-insulin-dependent diabetes mellitus: current status of the hypothesis. Diabetes Metab Rev 1993;9:231–236.[Medline]
  29. Kim HI, Kim JW, Kim SH, Cha JY, Kim KS, Ahn YH. Identification and functional characterization of the peroxisomal proliferator response element in rat GLUT2 promoter. Diabetes 2000;49:1517–1524.[Abstract]
  30. Kim JW, Ahn YH. CCAAT/enhancer binding protein regulates the promoter activity of the rat GLUT2 glucose transporter gene in liver cells. Biochem J 1998;336:83–90.
  31. Doria A, Plengvidhya N. Recent advances in the genetics of maturity-onset diabetes of the young and other forms of autosomal dominant diabetes. Curr Opin Endocrinol Diabetes 2000;7:203–210.



This article has been cited by other articles:


Home page
 Endocr. Rev.Home page
C. Bouche, S. Serdy, C. R. Kahn, and A. B. Goldfine
The Cellular Fate of Glucose and Its Relevance in Type 2 Diabetes
Endocr. Rev., October 1, 2004; 25(5): 807 - 830.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
B. D. Chiodini and C. M. Lewis
Meta-Analysis of 4 Coronary Heart Disease Genome-Wide Linkage Studies Confirms a Susceptibility Locus on Chromosome 3q
Arterioscler Thromb Vasc Biol, October 1, 2003; 23(10): 1863 - 1868.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cha, J.-y.
Right arrow Articles by Ahn, Y.-h.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cha, J.-y.
Right arrow Articles by Ahn, Y.-h.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS